PJA1 Rabbit Polyclonal Antibody
PJA1 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
PJA1 Polyclonal Antibody |
ES9632-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PJA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PJA1 Polyclonal Antibody |
ABP59920-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PJA1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PJA1 from Human. This PJA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PJA1 protein |
PJA1 Polyclonal Antibody |
ABP59920-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PJA1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PJA1 from Human. This PJA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PJA1 protein |
PJA1 Polyclonal Antibody |
ABP59920-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PJA1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PJA1 from Human. This PJA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PJA1 protein |
PJA1 Antibody |
45961-100ul |
SAB |
100ul |
EUR 252 |
PJA1 Antibody |
45961-50ul |
SAB |
50ul |
EUR 187 |
PJA1 antibody |
70R-19311 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PJA1 antibody |
PJA1 Antibody |
DF9487 |
Affbiotech |
200ul |
EUR 304 |
Description: PJA1 Antibody detects endogenous levels of total PJA1. |
PJA1 Antibody |
1-CSB-PA018049GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PJA1. Recognizes PJA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PJA1 Conjugated Antibody |
C45961 |
SAB |
100ul |
EUR 397 |
anti- PJA1 antibody |
FNab06477 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: praja ring finger 1
- Uniprot ID: Q8NG27
- Gene ID: 64219
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against PJA1 |
Anti-PJA1 antibody |
STJ190790 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PJA1 |
PJA1 siRNA |
20-abx928710 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PJA1 siRNA |
20-abx928711 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PJA1 Blocking Peptide |
DF9487-BP |
Affbiotech |
1mg |
EUR 195 |
PJA1 cloning plasmid |
CSB-CL844051HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1932
- Sequence: atgggtcaggaatctagcaagcctgtatggcccaatccaacaggagggtatcagtccaatacaggtaggaggtatggaagaaggcatgcttatgtcagtttcaggccacccacgagccagcgggaaaggattgccagccagagaaagacgaactccgaagtcccaatgcacagat
- Show more
|
Description: A cloning plasmid for the PJA1 gene. |
Mouse PJA1 shRNA Plasmid |
20-abx972053 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PJA1 shRNA Plasmid |
20-abx961962 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PJA1 Recombinant Protein (Human) |
RP023614 |
ABM |
100 ug |
Ask for price |
PJA1 Recombinant Protein (Mouse) |
RP162350 |
ABM |
100 ug |
Ask for price |
PJA1 Recombinant Protein (Mouse) |
RP162353 |
ABM |
100 ug |
Ask for price |
PJA1 ORF Vector (Human) (pORF) |
ORF007872 |
ABM |
1.0 ug DNA |
EUR 95 |
Pja1 ORF Vector (Mouse) (pORF) |
ORF054118 |
ABM |
1.0 ug DNA |
EUR 506 |
Pja1 ORF Vector (Mouse) (pORF) |
ORF054119 |
ABM |
1.0 ug DNA |
EUR 506 |
E3 Ubiquitin-Protein Ligase Praja-1 (PJA1) Antibody |
20-abx218331 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase Praja-1 (PJA1) Antibody |
abx236477-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
PJA1 sgRNA CRISPR Lentivector set (Human) |
K1654901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pja1 sgRNA CRISPR Lentivector set (Mouse) |
K3918101 |
ABM |
3 x 1.0 ug |
EUR 339 |
PJA1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1654902 |
ABM |
1.0 ug DNA |
EUR 154 |
PJA1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1654903 |
ABM |
1.0 ug DNA |
EUR 154 |
PJA1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1654904 |
ABM |
1.0 ug DNA |
EUR 154 |
Pja1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3918102 |
ABM |
1.0 ug DNA |
EUR 154 |
Pja1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3918103 |
ABM |
1.0 ug DNA |
EUR 154 |
Pja1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3918104 |
ABM |
1.0 ug DNA |
EUR 154 |
PJA1 Protein Vector (Human) (pPB-C-His) |
PV031485 |
ABM |
500 ng |
EUR 329 |
PJA1 Protein Vector (Human) (pPB-N-His) |
PV031486 |
ABM |
500 ng |
EUR 329 |
PJA1 Protein Vector (Human) (pPM-C-HA) |
PV031487 |
ABM |
500 ng |
EUR 329 |
PJA1 Protein Vector (Human) (pPM-C-His) |
PV031488 |
ABM |
500 ng |
EUR 329 |
PJA1 Protein Vector (Mouse) (pPB-C-His) |
PV216470 |
ABM |
500 ng |
EUR 603 |
PJA1 Protein Vector (Mouse) (pPB-N-His) |
PV216471 |
ABM |
500 ng |
EUR 603 |
PJA1 Protein Vector (Mouse) (pPM-C-HA) |
PV216472 |
ABM |
500 ng |
EUR 603 |
PJA1 Protein Vector (Mouse) (pPM-C-His) |
PV216473 |
ABM |
500 ng |
EUR 603 |
PJA1 Protein Vector (Mouse) (pPB-C-His) |
PV216474 |
ABM |
500 ng |
EUR 603 |
PJA1 Protein Vector (Mouse) (pPB-N-His) |
PV216475 |
ABM |
500 ng |
EUR 603 |
PJA1 Protein Vector (Mouse) (pPM-C-HA) |
PV216476 |
ABM |
500 ng |
EUR 603 |
PJA1 Protein Vector (Mouse) (pPM-C-His) |
PV216477 |
ABM |
500 ng |
EUR 603 |
Pja1 3'UTR GFP Stable Cell Line |
TU166430 |
ABM |
1.0 ml |
Ask for price |
PJA1 3'UTR Luciferase Stable Cell Line |
TU018128 |
ABM |
1.0 ml |
EUR 1394 |
Pja1 3'UTR Luciferase Stable Cell Line |
TU116430 |
ABM |
1.0 ml |
Ask for price |
PJA1 3'UTR GFP Stable Cell Line |
TU068128 |
ABM |
1.0 ml |
EUR 1394 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
PJA1 Rabbit Polyclonal Antibody