PJA1 Rabbit Polyclonal Antibody

PJA1 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

PJA1 Polyclonal Antibody

ES9632-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PJA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PJA1 Polyclonal Antibody

ABP59920-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PJA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PJA1 from Human. This PJA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PJA1 protein

PJA1 Polyclonal Antibody

ABP59920-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PJA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PJA1 from Human. This PJA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PJA1 protein

PJA1 Polyclonal Antibody

ABP59920-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PJA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PJA1 from Human. This PJA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PJA1 protein

PJA1 Antibody

ABD9487 100 ug
EUR 438

PJA1 Antibody

45961-100ul 100ul
EUR 252

PJA1 Antibody

45961-50ul 50ul
EUR 187

PJA1 antibody

70R-19311 50 ul
EUR 435
Description: Rabbit polyclonal PJA1 antibody

PJA1 Antibody

DF9487 200ul
EUR 304
Description: PJA1 Antibody detects endogenous levels of total PJA1.

PJA1 Antibody

1-CSB-PA018049GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PJA1. Recognizes PJA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PJA1 Conjugated Antibody

C45961 100ul
EUR 397

anti- PJA1 antibody

FNab06477 100µg
EUR 505.25
  • Immunogen: praja ring finger 1
  • Uniprot ID: Q8NG27
  • Gene ID: 64219
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against PJA1

Anti-PJA1 antibody

PAab06477 100 ug
EUR 355

Anti-PJA1 antibody

STJ190790 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PJA1

PJA1 siRNA

20-abx928710
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PJA1 siRNA

20-abx928711
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PJA1 Blocking Peptide

DF9487-BP 1mg
EUR 195

PJA1 cloning plasmid

CSB-CL844051HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1932
  • Sequence: atgggtcaggaatctagcaagcctgtatggcccaatccaacaggagggtatcagtccaatacaggtaggaggtatggaagaaggcatgcttatgtcagtttcaggccacccacgagccagcgggaaaggattgccagccagagaaagacgaactccgaagtcccaatgcacagat
  • Show more
Description: A cloning plasmid for the PJA1 gene.

PJA1 ELISA KIT|Human

EF001813 96 Tests
EUR 689

Mouse PJA1 shRNA Plasmid

20-abx972053
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PJA1 shRNA Plasmid

20-abx961962
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PJA1 Recombinant Protein (Human)

RP023614 100 ug Ask for price

PJA1 Recombinant Protein (Mouse)

RP162350 100 ug Ask for price

PJA1 Recombinant Protein (Mouse)

RP162353 100 ug Ask for price

PJA1 ORF Vector (Human) (pORF)

ORF007872 1.0 ug DNA
EUR 95

Pja1 ORF Vector (Mouse) (pORF)

ORF054118 1.0 ug DNA
EUR 506

Pja1 ORF Vector (Mouse) (pORF)

ORF054119 1.0 ug DNA
EUR 506

E3 Ubiquitin-Protein Ligase Praja-1 (PJA1) Antibody

20-abx218331
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase Praja-1 (PJA1) Antibody

abx236477-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PJA1 sgRNA CRISPR Lentivector set (Human)

K1654901 3 x 1.0 ug
EUR 339

Pja1 sgRNA CRISPR Lentivector set (Mouse)

K3918101 3 x 1.0 ug
EUR 339

PJA1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1654902 1.0 ug DNA
EUR 154

PJA1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1654903 1.0 ug DNA
EUR 154

PJA1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1654904 1.0 ug DNA
EUR 154

Pja1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3918102 1.0 ug DNA
EUR 154

Pja1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3918103 1.0 ug DNA
EUR 154

Pja1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3918104 1.0 ug DNA
EUR 154

PJA1 Protein Vector (Human) (pPB-C-His)

PV031485 500 ng
EUR 329

PJA1 Protein Vector (Human) (pPB-N-His)

PV031486 500 ng
EUR 329

PJA1 Protein Vector (Human) (pPM-C-HA)

PV031487 500 ng
EUR 329

PJA1 Protein Vector (Human) (pPM-C-His)

PV031488 500 ng
EUR 329

PJA1 Protein Vector (Mouse) (pPB-C-His)

PV216470 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPB-N-His)

PV216471 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPM-C-HA)

PV216472 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPM-C-His)

PV216473 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPB-C-His)

PV216474 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPB-N-His)

PV216475 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPM-C-HA)

PV216476 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPM-C-His)

PV216477 500 ng
EUR 603

Pja1 3'UTR GFP Stable Cell Line

TU166430 1.0 ml Ask for price

PJA1 3'UTR Luciferase Stable Cell Line

TU018128 1.0 ml
EUR 1394

Pja1 3'UTR Luciferase Stable Cell Line

TU116430 1.0 ml Ask for price

PJA1 3'UTR GFP Stable Cell Line

TU068128 1.0 ml
EUR 1394

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

PJA1 Rabbit Polyclonal Antibody