RIT2 Rabbit Polyclonal Antibody
RIT2 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
RIT2 Polyclonal Antibody |
A60614 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
RIT2 Polyclonal Antibody |
ABP60182-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RIT2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIT2 from Human, Mouse, Rat. This RIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIT2 protein |
RIT2 Polyclonal Antibody |
ABP60182-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RIT2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIT2 from Human, Mouse, Rat. This RIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIT2 protein |
RIT2 Polyclonal Antibody |
ABP60182-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RIT2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIT2 from Human, Mouse, Rat. This RIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIT2 protein |
RIT2 Polyclonal Antibody |
ES9694-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RIT2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RIT2 Polyclonal Antibody |
ES9694-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RIT2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RIT2 Rabbit pAb |
A13043-100ul |
Abclonal |
100 ul |
EUR 308 |
RIT2 Rabbit pAb |
A13043-200ul |
Abclonal |
200 ul |
EUR 459 |
RIT2 Rabbit pAb |
A13043-20ul |
Abclonal |
20 ul |
EUR 183 |
RIT2 Rabbit pAb |
A13043-50ul |
Abclonal |
50 ul |
EUR 223 |
RIT2 Polyclonal Conjugated Antibody |
C27869 |
SAB |
100ul |
EUR 397 |
RIT2 antibody |
10R-5625 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal RIT2 antibody |
RIT2 antibody |
10R-5626 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal RIT2 antibody |
RIT2 Antibody |
1-CSB-PA860769LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal RIT2 Antibody (N-term) |
AMM08676G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIT2 (N-term). This antibody is tested and proven to work in the following applications: |
RIT2 Polyclonal Antibody, Biotin Conjugated |
A60615 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
RIT2 Polyclonal Antibody, FITC Conjugated |
A60616 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
RIT2 Polyclonal Antibody, HRP Conjugated |
A60617 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
GTP-Binding Protein Rit2 (RIT2) Antibody |
abx145163-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
GTP-Binding Protein Rit2 (RIT2) Antibody |
abx028897-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
GTP-Binding Protein Rit2 (RIT2) Antibody |
abx028897-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
GTP-Binding Protein Rit2 (RIT2) Antibody |
20-abx310582 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GTP-Binding Protein Rit2 (RIT2) Antibody (HRP) |
20-abx310583 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GTP-Binding Protein Rit2 (RIT2) Antibody (FITC) |
20-abx310584 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GTP-Binding Protein Rit2 (RIT2) Antibody (Biotin) |
20-abx310585 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-RIT2 antibody |
STJ190852 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RIT2 |
RIT2 siRNA |
20-abx904587 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIT2 siRNA |
20-abx931577 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIT2 siRNA |
20-abx931578 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RIT2 |
YF-PA14393 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to RIT2 |
anti-RIT2 |
YF-PA14394 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to RIT2 |
RIT2 Antibody, HRP conjugated |
1-CSB-PA860769LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RIT2 Antibody, FITC conjugated |
1-CSB-PA860769LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RIT2 Antibody, Biotin conjugated |
1-CSB-PA860769LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human GTP- binding protein Rit2, RIT2 ELISA KIT |
ELI-52510h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse GTP- binding protein Rit2, Rit2 ELISA KIT |
ELI-35629m |
Lifescience Market |
96 Tests |
EUR 865 |
RIT2 cloning plasmid |
CSB-CL860769HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 654
- Sequence: atggaggtagaaaatgaagccagctgctccccgggcagcgcatcaggcgggtccagagagtacaaggtggtaatgctgggagcagggggagttggtaaaagcgcaatgacaatgcagtttattagtcatcagttccctgattatcatgaccctactatagaagatgcttataagac
- Show more
|
Description: A cloning plasmid for the RIT2 gene. |
Anti-RIT2 (3F2) |
YF-MA15198 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RIT2 |
Rat RIT2 shRNA Plasmid |
20-abx988520 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RIT2 shRNA Plasmid |
20-abx972459 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RIT2 shRNA Plasmid |
20-abx954080 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rit2 Recombinant Protein (Human) |
RP026488 |
ABM |
100 ug |
Ask for price |
Rit2 Recombinant Protein (Mouse) |
RP168311 |
ABM |
100 ug |
Ask for price |
Rit2 Recombinant Protein (Rat) |
RP226187 |
ABM |
100 ug |
Ask for price |
Monoclonal RIT2 Antibody (monoclonal) (M01), Clone: 3F2 |
AMM07621G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human RIT2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F2. This antibody is applicable in WB, E |
Rit2 ORF Vector (Rat) (pORF) |
ORF075397 |
ABM |
1.0 ug DNA |
EUR 506 |
RIT2 ORF Vector (Human) (pORF) |
ORF008830 |
ABM |
1.0 ug DNA |
EUR 95 |
Rit2 ORF Vector (Mouse) (pORF) |
ORF056105 |
ABM |
1.0 ug DNA |
EUR 506 |
Monoclonal RIT2 / RIN Antibody (clone 27G2), Clone: 27G2 |
AMM07620G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human RIT2 / RIN (clone 27G2). The antibodies are raised in Mouse and are from clone 27G2. This antibody is applicable in WB and IHC-P |
Rit2 sgRNA CRISPR Lentivector set (Rat) |
K7427501 |
ABM |
3 x 1.0 ug |
EUR 339 |
RIT2 sgRNA CRISPR Lentivector set (Human) |
K1826501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rit2 sgRNA CRISPR Lentivector set (Mouse) |
K3399301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rit2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7427502 |
ABM |
1.0 ug DNA |
EUR 154 |
Rit2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7427503 |
ABM |
1.0 ug DNA |
EUR 154 |
Rit2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7427504 |
ABM |
1.0 ug DNA |
EUR 154 |
RIT2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1826502 |
ABM |
1.0 ug DNA |
EUR 154 |
RIT2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1826503 |
ABM |
1.0 ug DNA |
EUR 154 |
RIT2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1826504 |
ABM |
1.0 ug DNA |
EUR 154 |
Rit2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3399302 |
ABM |
1.0 ug DNA |
EUR 154 |
Rit2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3399303 |
ABM |
1.0 ug DNA |
EUR 154 |
Rit2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3399304 |
ABM |
1.0 ug DNA |
EUR 154 |
Rit2 Protein Vector (Rat) (pPB-C-His) |
PV301586 |
ABM |
500 ng |
EUR 603 |
Rit2 Protein Vector (Rat) (pPB-N-His) |
PV301587 |
ABM |
500 ng |
EUR 603 |
Rit2 Protein Vector (Rat) (pPM-C-HA) |
PV301588 |
ABM |
500 ng |
EUR 603 |
Rit2 Protein Vector (Rat) (pPM-C-His) |
PV301589 |
ABM |
500 ng |
EUR 603 |
Rit2 Protein Vector (Human) (pPB-C-His) |
PV035317 |
ABM |
500 ng |
EUR 329 |
Rit2 Protein Vector (Human) (pPB-N-His) |
PV035318 |
ABM |
500 ng |
EUR 329 |
Rit2 Protein Vector (Human) (pPM-C-HA) |
PV035319 |
ABM |
500 ng |
EUR 329 |
Rit2 Protein Vector (Human) (pPM-C-His) |
PV035320 |
ABM |
500 ng |
EUR 329 |
Rit2 Protein Vector (Mouse) (pPB-C-His) |
PV224418 |
ABM |
500 ng |
EUR 603 |
Rit2 Protein Vector (Mouse) (pPB-N-His) |
PV224419 |
ABM |
500 ng |
EUR 603 |
Rit2 Protein Vector (Mouse) (pPM-C-HA) |
PV224420 |
ABM |
500 ng |
EUR 603 |
Rit2 Protein Vector (Mouse) (pPM-C-His) |
PV224421 |
ABM |
500 ng |
EUR 603 |
Rit2 3'UTR Luciferase Stable Cell Line |
TU117911 |
ABM |
1.0 ml |
Ask for price |
Rit2 3'UTR GFP Stable Cell Line |
TU167911 |
ABM |
1.0 ml |
Ask for price |
Rit2 3'UTR Luciferase Stable Cell Line |
TU219463 |
ABM |
1.0 ml |
Ask for price |
Rit2 3'UTR GFP Stable Cell Line |
TU269463 |
ABM |
1.0 ml |
Ask for price |
RIT2 3'UTR GFP Stable Cell Line |
TU069943 |
ABM |
1.0 ml |
EUR 1394 |
RIT2 3'UTR Luciferase Stable Cell Line |
TU019943 |
ABM |
1.0 ml |
EUR 1394 |
Rit2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV695077 |
ABM |
1.0 ug DNA |
EUR 514 |
Rit2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV695081 |
ABM |
1.0 ug DNA |
EUR 514 |
Rit2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV695082 |
ABM |
1.0 ug DNA |
EUR 514 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
RIT2 Rabbit Polyclonal Antibody