RIT2 Rabbit Polyclonal Antibody
RIT2 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 RIT2 Polyclonal Antibody |
|
ABP60182-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RIT2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RIT2 from Human, Mouse, Rat. This RIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIT2 protein |
RIT2 Polyclonal Antibody |
|
ABP60182-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RIT2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RIT2 from Human, Mouse, Rat. This RIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIT2 protein |
RIT2 Polyclonal Antibody |
|
ABP60182-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RIT2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RIT2 from Human, Mouse, Rat. This RIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIT2 protein |
RIT2 Polyclonal Antibody |
|
A60614 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
RIT2 Polyclonal Antibody |
|
27869-100ul |
SAB |
100ul |
EUR 252 |
RIT2 Polyclonal Antibody |
|
27869-50ul |
SAB |
50ul |
EUR 187 |
 RIT2 Rabbit pAb |
|
A13043-100ul |
Abclonal |
100 ul |
EUR 308 |
RIT2 Rabbit pAb |
|
A13043-200ul |
Abclonal |
200 ul |
EUR 459 |
RIT2 Rabbit pAb |
|
A13043-20ul |
Abclonal |
20 ul |
EUR 183 |
RIT2 Rabbit pAb |
|
A13043-50ul |
Abclonal |
50 ul |
EUR 223 |
 RIT2 Polyclonal Conjugated Antibody |
|
C27869 |
SAB |
100ul |
EUR 397 |
 RIT2 antibody |
|
10R-5625 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal RIT2 antibody |
RIT2 antibody |
|
10R-5626 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal RIT2 antibody |
 RIT2 Antibody |
|
1-CSB-PA860769LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
) Polyclonal RIT2 Antibody (N-term) |
|
AMM08676G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIT2 (N-term). This antibody is tested and proven to work in the following applications: |
 RIT2 Polyclonal Antibody, Biotin Conjugated |
|
A60615 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 RIT2 Polyclonal Antibody, FITC Conjugated |
|
A60616 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 RIT2 Polyclonal Antibody, HRP Conjugated |
|
A60617 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 Antibody) GTP-Binding Protein Rit2 (RIT2) Antibody |
|
abx145163-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
GTP-Binding Protein Rit2 (RIT2) Antibody |
|
abx028897-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
GTP-Binding Protein Rit2 (RIT2) Antibody |
|
abx028897-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
GTP-Binding Protein Rit2 (RIT2) Antibody |
|
20-abx310582 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) GTP-Binding Protein Rit2 (RIT2) Antibody (HRP) |
|
20-abx310583 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) GTP-Binding Protein Rit2 (RIT2) Antibody (FITC) |
|
20-abx310584 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) GTP-Binding Protein Rit2 (RIT2) Antibody (Biotin) |
|
20-abx310585 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-RIT2 antibody |
|
STJ190852 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RIT2 |
 RIT2 siRNA |
|
20-abx904587 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIT2 siRNA |
|
20-abx931577 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIT2 siRNA |
|
20-abx931578 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-RIT2 |
|
YF-PA14393 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to RIT2 |
anti-RIT2 |
|
YF-PA14394 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to RIT2 |
 RIT2 Antibody, HRP conjugated |
|
1-CSB-PA860769LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 RIT2 Antibody, FITC conjugated |
|
1-CSB-PA860769LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 RIT2 Antibody, Biotin conjugated |
|
1-CSB-PA860769LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Human GTP- binding protein Rit2, RIT2 ELISA KIT |
|
ELI-52510h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse GTP- binding protein Rit2, Rit2 ELISA KIT |
|
ELI-35629m |
Lifescience Market |
96 Tests |
EUR 865 |
 RIT2 cloning plasmid |
|
CSB-CL860769HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 654
- Sequence: atggaggtagaaaatgaagccagctgctccccgggcagcgcatcaggcgggtccagagagtacaaggtggtaatgctgggagcagggggagttggtaaaagcgcaatgacaatgcagtttattagtcatcagttccctgattatcatgaccctactatagaagatgcttataagac
- Show more
|
|
Description: A cloning plasmid for the RIT2 gene. |
) Anti-RIT2 (3F2) |
|
YF-MA15198 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to RIT2 |
 Rat RIT2 shRNA Plasmid |
|
20-abx988520 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human RIT2 shRNA Plasmid |
|
20-abx954080 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse RIT2 shRNA Plasmid |
|
20-abx972459 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) Rit2 Recombinant Protein (Human) |
|
RP026488 |
ABM |
100 ug |
Ask for price |
) Rit2 Recombinant Protein (Rat) |
|
RP226187 |
ABM |
100 ug |
Ask for price |
) Rit2 Recombinant Protein (Mouse) |
|
RP168311 |
ABM |
100 ug |
Ask for price |
 (M01), Clone: 3F2) Monoclonal RIT2 Antibody (monoclonal) (M01), Clone: 3F2 |
|
AMM07621G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human RIT2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F2. This antibody is applicable in WB, E |
 (pORF)) RIT2 ORF Vector (Human) (pORF) |
|
ORF008830 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Rit2 ORF Vector (Mouse) (pORF) |
|
ORF056105 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Rit2 ORF Vector (Rat) (pORF) |
|
ORF075397 |
ABM |
1.0 ug DNA |
EUR 506 |
, Clone: 27G2) Monoclonal RIT2 / RIN Antibody (clone 27G2), Clone: 27G2 |
|
AMM07620G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human RIT2 / RIN (clone 27G2). The antibodies are raised in Mouse and are from clone 27G2. This antibody is applicable in WB and IHC-P |
) RIT2 sgRNA CRISPR Lentivector set (Human) |
|
K1826501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rit2 sgRNA CRISPR Lentivector set (Rat) |
|
K7427501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rit2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3399301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) RIT2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1826502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) RIT2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1826503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) RIT2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1826504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rit2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7427502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rit2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7427503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rit2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7427504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rit2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3399302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rit2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3399303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rit2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3399304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) Rit2 Protein Vector (Human) (pPB-C-His) |
|
PV035317 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) Rit2 Protein Vector (Human) (pPB-N-His) |
|
PV035318 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) Rit2 Protein Vector (Human) (pPM-C-HA) |
|
PV035319 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) Rit2 Protein Vector (Human) (pPM-C-His) |
|
PV035320 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) Rit2 Protein Vector (Rat) (pPB-C-His) |
|
PV301586 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) Rit2 Protein Vector (Rat) (pPB-N-His) |
|
PV301587 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) Rit2 Protein Vector (Rat) (pPM-C-HA) |
|
PV301588 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) Rit2 Protein Vector (Rat) (pPM-C-His) |
|
PV301589 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) Rit2 Protein Vector (Mouse) (pPB-C-His) |
|
PV224418 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) Rit2 Protein Vector (Mouse) (pPB-N-His) |
|
PV224419 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) Rit2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV224420 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) Rit2 Protein Vector (Mouse) (pPM-C-His) |
|
PV224421 |
ABM |
500 ng |
EUR 603 |
 Rit2 3'UTR GFP Stable Cell Line |
|
TU167911 |
ABM |
1.0 ml |
Ask for price |
 RIT2 3'UTR Luciferase Stable Cell Line |
|
TU019943 |
ABM |
1.0 ml |
EUR 1394 |
 Rit2 3'UTR Luciferase Stable Cell Line |
|
TU117911 |
ABM |
1.0 ml |
Ask for price |
 RIT2 3'UTR GFP Stable Cell Line |
|
TU069943 |
ABM |
1.0 ml |
EUR 1394 |
Rit2 3'UTR Luciferase Stable Cell Line |
|
TU219463 |
ABM |
1.0 ml |
Ask for price |
Rit2 3'UTR GFP Stable Cell Line |
|
TU269463 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) Rit2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV695077 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) Rit2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV695081 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) Rit2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV695082 |
ABM |
1.0 ug DNA |
EUR 514 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
RIT2 Rabbit Polyclonal Antibody
