RNF41 Rabbit Polyclonal Antibody

RNF41 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

RNF41 Polyclonal Antibody
ABP60220-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RNF41 protein Applications tips:
Description: A polyclonal antibody for detection of RNF41 from Human, Mouse. This RNF41 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF41 protein

RNF41 Polyclonal Antibody
ABP60220-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RNF41 protein Applications tips:
Description: A polyclonal antibody for detection of RNF41 from Human, Mouse. This RNF41 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF41 protein

RNF41 Polyclonal Antibody
ES9631-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RNF41 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RNF41 Polyclonal Antibody
ES9631-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RNF41 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RNF41 Antibody
45960-100ul	SAB	100ul	EUR 252

RNF41 Antibody
45960-50ul	SAB	50ul	EUR 187

RNF41 Antibody
1-CSB-PA880976ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RNF41. Recognizes RNF41 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RNF41 Antibody
DF9486	Affbiotech	200ul	EUR 304
Description: RNF41 Antibody detects endogenous levels of total RNF41.

RNF41 Antibody
ABD9486	Lifescience Market	100 ug	EUR 438

Polyclonal RNF41 Antibody (C-term)
APR04327G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RNF41 (C-term). This antibody is tested and proven to work in the following applications:

RNF41 Conjugated Antibody
C45960	SAB	100ul	EUR 397

anti- RNF41 antibody
FNab07359	FN Test	100µg	EUR 548.75
Immunogen: ring finger protein 41 Uniprot ID: Q9H4P4 Gene ID: 10193 Research Area: Epigenetics, Metabolism
Description: Antibody raised against RNF41

Anti-RNF41 antibody
PAab07359	Lifescience Market	100 ug	EUR 386

Anti-RNF41 antibody
STJ190789	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RNF41

RNF41 siRNA
20-abx931794	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF41 siRNA
20-abx931795	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-RNF41
YF-PA16776	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RNF41

anti-RNF41
YF-PA16777	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RNF41

anti-RNF41
YF-PA16778	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to RNF41

anti-RNF41
YF-PA25503	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RNF41

RNF41 Blocking Peptide
DF9486-BP	Affbiotech	1mg	EUR 195

RNF41 cloning plasmid
CSB-CL880976HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 954 Sequence: atggggtatgatgtaacccgtttccagggggatgttgacgaagatcttatctgccctatttgcagtggagtcttggaggagccagtacaggcacctcattgtgaacatgctttctgcaacgcctgcatcacccagtggttctctcagcaacagacatgtccagtggaccgtagtgt Show more
Description: A cloning plasmid for the RNF41 gene.

pCDNA3.1-Rnf41-m
PVT14262	Lifescience Market	2 ug	EUR 599

Anti-RNF41 (4C2)
YF-MA17168	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to RNF41

Human RNF41 ELISA kit
ELI-18493h	Lifescience Market	96 Tests	EUR 824

RNF41 ELISA KIT|Human
EF002527	Lifescience Market	96 Tests	EUR 689

Mouse RNF41 shRNA Plasmid
20-abx976224	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RNF41 shRNA Plasmid
20-abx956882	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RNF41 ELISA kit
ELI-40878m	Lifescience Market	96 Tests	EUR 865

RNF41 Recombinant Protein (Human)
RP026692	ABM	100 ug	Ask for price

RNF41 Recombinant Protein (Mouse)
RP168668	ABM	100 ug	Ask for price

RNF41 Recombinant Protein (Mouse)
RP168671	ABM	100 ug	Ask for price

RNF41 Recombinant Protein (Rat)
RP226451	ABM	100 ug	Ask for price

Ring Finger Protein 41 (RNF41) Antibody
20-abx218328	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Ring Finger Protein 41 (RNF41) Antibody
abx145584-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ring Finger Protein 41 (RNF41) Antibody
abx030397-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ring Finger Protein 41 (RNF41) Antibody
abx030397-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ring Finger Protein 41 (RNF41) Antibody
abx237359-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ring Finger Protein 41 (RNF41) Antibody
20-abx322616	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Monoclonal RNF41 Antibody (monoclonal) (M01A), Clone: 4C2
AMM04030G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human RNF41 (monoclonal) (M01A). The antibodies are raised in mouse and are from clone 4C2. This antibody is applicable in WB

Rnf41 ORF Vector (Rat) (pORF)
ORF075485	ABM	1.0 ug DNA	EUR 506

RNF41 ORF Vector (Human) (pORF)
ORF008898	ABM	1.0 ug DNA	EUR 95

Rnf41 ORF Vector (Mouse) (pORF)
ORF056224	ABM	1.0 ug DNA	EUR 506

Rnf41 ORF Vector (Mouse) (pORF)
ORF056225	ABM	1.0 ug DNA	EUR 506

pECMV-Rnf41-m-Myc-FLAG
PVT14274	Lifescience Market	2 ug	EUR 599

Rnf41 sgRNA CRISPR Lentivector set (Rat)
K6550101	ABM	3 x 1.0 ug	EUR 339

Rnf41 sgRNA CRISPR Lentivector set (Mouse)
K4828401	ABM	3 x 1.0 ug	EUR 339

RNF41 sgRNA CRISPR Lentivector set (Human)
K1836401	ABM	3 x 1.0 ug	EUR 339

Human E3 ubiquitin-protein ligase NRDP1 (RNF41)
1-CSB-EP880976HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 62.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase NRDP1(RNF41) expressed in E.coli

Rnf41 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6550102	ABM	1.0 ug DNA	EUR 154

Rnf41 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6550103	ABM	1.0 ug DNA	EUR 154

Rnf41 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6550104	ABM	1.0 ug DNA	EUR 154

Rnf41 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4828402	ABM	1.0 ug DNA	EUR 154

Rnf41 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4828403	ABM	1.0 ug DNA	EUR 154

Rnf41 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4828404	ABM	1.0 ug DNA	EUR 154

RNF41 sgRNA CRISPR Lentivector (Human) (Target 1)
K1836402	ABM	1.0 ug DNA	EUR 154

RNF41 sgRNA CRISPR Lentivector (Human) (Target 2)
K1836403	ABM	1.0 ug DNA	EUR 154

RNF41 sgRNA CRISPR Lentivector (Human) (Target 3)
K1836404	ABM	1.0 ug DNA	EUR 154

RNF41 Protein Vector (Rat) (pPB-C-His)
PV301938	ABM	500 ng	EUR 603

RNF41 Protein Vector (Rat) (pPB-N-His)
PV301939	ABM	500 ng	EUR 603

RNF41 Protein Vector (Rat) (pPM-C-HA)
PV301940	ABM	500 ng	EUR 603

RNF41 Protein Vector (Rat) (pPM-C-His)
PV301941	ABM	500 ng	EUR 603

RNF41 Protein Vector (Human) (pPB-C-His)
PV035589	ABM	500 ng	EUR 329

RNF41 Protein Vector (Human) (pPB-N-His)
PV035590	ABM	500 ng	EUR 329

RNF41 Protein Vector (Human) (pPM-C-HA)
PV035591	ABM	500 ng	EUR 329

RNF41 Protein Vector (Human) (pPM-C-His)
PV035592	ABM	500 ng	EUR 329

RNF41 Protein Vector (Mouse) (pPB-C-His)
PV224894	ABM	500 ng	EUR 603

RNF41 Protein Vector (Mouse) (pPB-N-His)
PV224895	ABM	500 ng	EUR 603

RNF41 Protein Vector (Mouse) (pPM-C-HA)
PV224896	ABM	500 ng	EUR 603

RNF41 Protein Vector (Mouse) (pPM-C-His)
PV224897	ABM	500 ng	EUR 603

RNF41 Protein Vector (Mouse) (pPB-C-His)
PV224898	ABM	500 ng	EUR 603

RNF41 Protein Vector (Mouse) (pPB-N-His)
PV224899	ABM	500 ng	EUR 603

RNF41 Protein Vector (Mouse) (pPM-C-HA)
PV224900	ABM	500 ng	EUR 603

RNF41 Protein Vector (Mouse) (pPM-C-His)
PV224901	ABM	500 ng	EUR 603

Rnf41 3'UTR Luciferase Stable Cell Line
TU118012	ABM	1.0 ml	Ask for price

Rnf41 3'UTR GFP Stable Cell Line
TU168012	ABM	1.0 ml	Ask for price

Rnf41 3'UTR Luciferase Stable Cell Line
TU219561	ABM	1.0 ml	Ask for price

Rnf41 3'UTR GFP Stable Cell Line
TU269561	ABM	1.0 ml	Ask for price

RNF41 3'UTR GFP Stable Cell Line
TU070048	ABM	1.0 ml	EUR 1521

RNF41 Rabbit Polyclonal Antibody