RNF5 Rabbit Polyclonal Antibody
RNF5 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
RNF5 Polyclonal Antibody |
ES9635-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RNF5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RNF5 Polyclonal Antibody |
ABP60221-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RNF5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RNF5 from Human, Mouse, Rat. This RNF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF5 protein |
RNF5 Polyclonal Antibody |
ABP60221-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RNF5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RNF5 from Human, Mouse, Rat. This RNF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF5 protein |
RNF5 Polyclonal Antibody |
ABP60221-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RNF5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RNF5 from Human, Mouse, Rat. This RNF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF5 protein |
RNF5 Rabbit pAb |
A8351-100ul |
Abclonal |
100 ul |
EUR 308 |
RNF5 Rabbit pAb |
A8351-200ul |
Abclonal |
200 ul |
EUR 459 |
RNF5 Rabbit pAb |
A8351-20ul |
Abclonal |
20 ul |
EUR 183 |
RNF5 Rabbit pAb |
A8351-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal RNF5 Antibody (Center) |
APR03695G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RNF5 (Center). This antibody is tested and proven to work in the following applications: |
RNF5 antibody |
70R-9592 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal RNF5 antibody |
RNF5 Antibody |
37869-100ul |
SAB |
100ul |
EUR 252 |
RNF5 Antibody |
DF9490 |
Affbiotech |
200ul |
EUR 304 |
Description: RNF5 Antibody detects endogenous levels of total RNF5. |
RNF5 Antibody |
1-CSB-PA345004 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
RNF5 Antibody |
1-CSB-PA857879DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
RNF5 Antibody |
1-CSB-PA857879DSR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
RNF5 Antibody |
1-CSB-PA034142 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
Polyclonal RNF5 Antibody (N-term) |
APR11182G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RNF5 (N-term). This antibody is tested and proven to work in the following applications: |
RNF5 Conjugated Antibody |
C37869 |
SAB |
100ul |
EUR 397 |
Anti-RNF5 antibody |
STJ110649 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene contains a RING finger, which is a motif known to be involved in protein-protein interactions. This protein is a membrane-bound ubiquitin ligase. It can regulate cell motility by targeting paxillin ubiquitination and altering the distribution and localization of paxillin in cytoplasm and cell focal adhesions. |
Anti-RNF5 antibody |
STJ190793 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RNF5 |
RNF5 siRNA |
20-abx904622 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNF5 siRNA |
20-abx931802 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNF5 siRNA |
20-abx931803 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNF5 Blocking Peptide |
33R-1002 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IRX3 antibody, catalog no. 70R-8548 |
RNF5 cloning plasmid |
CSB-CL857879HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 543
- Sequence: atggcagcagcggaggaggaggacgggggccccgaagggccaaatcgcgagcggggcggggcgggcgcgaccttcgaatgtaatatatgtttggagactgctcgggaagctgtggtcagtgtgtgtggccacctgtactgttggccatgtcttcatcagtggctggagacacggcc
- Show more
|
Description: A cloning plasmid for the RNF5 gene. |
RNF5 cloning plasmid |
CSB-CL857879HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 543
- Sequence: ATGGCAGCAGCGGAGGAGGAGGACGGGGGCCCCGAAGGGCCAAATCGCGAGCGGGGCGGGGCGGGCGCGACCTTCGAATGTAATATATGTTTGGAGACTGCTCGGGAAGCTGTGGTCAGTGTGTGTGGCCACCTGTACTGTTGGCCATGTCTTCATCAGTGGCTGGAGACACGGCC
- Show more
|
Description: A cloning plasmid for the RNF5 gene. |
RNF5 cloning plasmid |
CSB-CL857879HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 543
- Sequence: ATGGCAGCAGCGGAGGAGGAGGACGGGGGCCCCGAAGGGCCAAATCGCGAGCGGGGCGGGGCGGGCGCGACCTTCGAATGTAATATATGTTTGGAGACTGCTCGGGAAGCTGTGGTCAGTGTGTGTGGCCACCTGTACTGTTGGCCATGTCTTCATCAGTGGCTGGAGACACGGCC
- Show more
|
Description: A cloning plasmid for the RNF5 gene. |
RNF5 Blocking Peptide |
DF9490-BP |
Affbiotech |
1mg |
EUR 195 |
Human E3 ubiquitin- protein ligase RNF5, RNF5 ELISA KIT |
ELI-44970h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse E3 ubiquitin- protein ligase RNF5, Rnf5 ELISA KIT |
ELI-41165m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse RNF5 shRNA Plasmid |
20-abx974444 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RNF5 shRNA Plasmid |
20-abx954095 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat RNF5 shRNA Plasmid |
20-abx990737 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RNF5 Recombinant Protein (Human) |
RP026695 |
ABM |
100 ug |
Ask for price |
RNF5 Recombinant Protein (Human) |
RP042967 |
ABM |
100 ug |
Ask for price |
RNF5 Recombinant Protein (Human) |
RP042970 |
ABM |
100 ug |
Ask for price |
RNF5 Recombinant Protein (Rat) |
RP226460 |
ABM |
100 ug |
Ask for price |
RNF5 Recombinant Protein (Mouse) |
RP168689 |
ABM |
100 ug |
Ask for price |
Ring Finger Protein 5 (RNF5) Antibody |
20-abx142198 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Ring Finger Protein 5 (RNF5) Antibody |
abx034022-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ring Finger Protein 5 (RNF5) Antibody |
abx034022-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ring Finger Protein 5 (RNF5) Antibody |
20-abx006132 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ring Finger Protein 5 (RNF5) Antibody |
abx026814-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ring Finger Protein 5 (RNF5) Antibody |
abx026814-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ring Finger Protein 5 (RNF5) Antibody |
20-abx321987 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ring Finger Protein 5 (RNF5) Antibody |
20-abx322617 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ring Finger Protein 5 (RNF5) Antibody |
20-abx241993 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ring Finger Protein 5 (RNF5) Antibody |
20-abx241994 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNF5 ORF Vector (Human) (pORF) |
ORF008899 |
ABM |
1.0 ug DNA |
EUR 95 |
Rnf5 ORF Vector (Mouse) (pORF) |
ORF056231 |
ABM |
1.0 ug DNA |
EUR 506 |
Rnf5 ORF Vector (Rat) (pORF) |
ORF075488 |
ABM |
1.0 ug DNA |
EUR 506 |
RNF5 ORF Vector (Human) (pORF) |
ORF014323 |
ABM |
1.0 ug DNA |
EUR 354 |
RNF5 ORF Vector (Human) (pORF) |
ORF014324 |
ABM |
1.0 ug DNA |
EUR 354 |
RNF5 sgRNA CRISPR Lentivector set (Human) |
K1834001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rnf5 sgRNA CRISPR Lentivector set (Rat) |
K7460801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rnf5 sgRNA CRISPR Lentivector set (Mouse) |
K4928401 |
ABM |
3 x 1.0 ug |
EUR 339 |
RNF5 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1834002 |
ABM |
1.0 ug DNA |
EUR 154 |
RNF5 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1834003 |
ABM |
1.0 ug DNA |
EUR 154 |
RNF5 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1834004 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnf5 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7460802 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnf5 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7460803 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnf5 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7460804 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnf5 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4928402 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnf5 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4928403 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnf5 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4928404 |
ABM |
1.0 ug DNA |
EUR 154 |
RNF5 Protein Vector (Human) (pPB-C-His) |
PV057289 |
ABM |
500 ng |
EUR 481 |
RNF5 Protein Vector (Human) (pPB-N-His) |
PV057290 |
ABM |
500 ng |
EUR 481 |
RNF5 Protein Vector (Human) (pPM-C-HA) |
PV057291 |
ABM |
500 ng |
EUR 481 |
RNF5 Protein Vector (Human) (pPM-C-His) |
PV057292 |
ABM |
500 ng |
EUR 481 |
RNF5 Protein Vector (Human) (pPB-C-His) |
PV057293 |
ABM |
500 ng |
EUR 481 |
RNF5 Protein Vector (Human) (pPB-N-His) |
PV057294 |
ABM |
500 ng |
EUR 481 |
RNF5 Protein Vector (Human) (pPM-C-HA) |
PV057295 |
ABM |
500 ng |
EUR 481 |
RNF5 Protein Vector (Human) (pPM-C-His) |
PV057296 |
ABM |
500 ng |
EUR 481 |
RNF5 Protein Vector (Human) (pPB-C-His) |
PV035593 |
ABM |
500 ng |
EUR 329 |
RNF5 Protein Vector (Human) (pPB-N-His) |
PV035594 |
ABM |
500 ng |
EUR 329 |
RNF5 Protein Vector (Human) (pPM-C-HA) |
PV035595 |
ABM |
500 ng |
EUR 329 |
RNF5 Protein Vector (Human) (pPM-C-His) |
PV035596 |
ABM |
500 ng |
EUR 329 |
RNF5 Protein Vector (Rat) (pPB-C-His) |
PV301950 |
ABM |
500 ng |
EUR 603 |
RNF5 Protein Vector (Rat) (pPB-N-His) |
PV301951 |
ABM |
500 ng |
EUR 603 |
RNF5 Protein Vector (Rat) (pPM-C-HA) |
PV301952 |
ABM |
500 ng |
EUR 603 |
RNF5 Rabbit Polyclonal Antibody