RNF5 Rabbit Polyclonal Antibody

RNF5 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

RNF5 Polyclonal Antibody
ES9635-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RNF5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RNF5 Polyclonal Antibody
ABP60221-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RNF5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RNF5 from Human, Mouse, Rat. This RNF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF5 protein
RNF5 Polyclonal Antibody
ABP60221-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RNF5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RNF5 from Human, Mouse, Rat. This RNF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF5 protein
RNF5 Polyclonal Antibody
ABP60221-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RNF5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RNF5 from Human, Mouse, Rat. This RNF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF5 protein
RNF5 Rabbit pAb
A8351-100ul 100 ul
EUR 308
RNF5 Rabbit pAb
A8351-200ul 200 ul
EUR 459
RNF5 Rabbit pAb
A8351-20ul 20 ul
EUR 183
RNF5 Rabbit pAb
A8351-50ul 50 ul
EUR 223
Polyclonal RNF5 Antibody (Center)
APR03695G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RNF5 (Center). This antibody is tested and proven to work in the following applications:
RNF5 Antibody
ABD9490 100 ug
EUR 438
RNF5 antibody
70R-9592 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RNF5 antibody
RNF5 Antibody
37869-100ul 100ul
EUR 252
RNF5 Antibody
DF9490 200ul
EUR 304
Description: RNF5 Antibody detects endogenous levels of total RNF5.
RNF5 Antibody
1-CSB-PA345004
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
RNF5 Antibody
1-CSB-PA857879DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
RNF5 Antibody
1-CSB-PA857879DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
RNF5 Antibody
1-CSB-PA034142
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
Polyclonal RNF5 Antibody (N-term)
APR11182G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RNF5 (N-term). This antibody is tested and proven to work in the following applications:
Rnf5/ Rat Rnf5 ELISA Kit
ELI-18515r 96 Tests
EUR 886
RNF5 Conjugated Antibody
C37869 100ul
EUR 397
Anti-RNF5 antibody
STJ110649 100 µl
EUR 277
Description: The protein encoded by this gene contains a RING finger, which is a motif known to be involved in protein-protein interactions. This protein is a membrane-bound ubiquitin ligase. It can regulate cell motility by targeting paxillin ubiquitination and altering the distribution and localization of paxillin in cytoplasm and cell focal adhesions.
Anti-RNF5 antibody
STJ190793 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RNF5
RNF5 siRNA
20-abx904622
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RNF5 siRNA
20-abx931802
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RNF5 siRNA
20-abx931803
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RNF5 Blocking Peptide
33R-1002 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IRX3 antibody, catalog no. 70R-8548
RNF5 cloning plasmid
CSB-CL857879HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: atggcagcagcggaggaggaggacgggggccccgaagggccaaatcgcgagcggggcggggcgggcgcgaccttcgaatgtaatatatgtttggagactgctcgggaagctgtggtcagtgtgtgtggccacctgtactgttggccatgtcttcatcagtggctggagacacggcc
  • Show more
Description: A cloning plasmid for the RNF5 gene.
RNF5 cloning plasmid
CSB-CL857879HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: ATGGCAGCAGCGGAGGAGGAGGACGGGGGCCCCGAAGGGCCAAATCGCGAGCGGGGCGGGGCGGGCGCGACCTTCGAATGTAATATATGTTTGGAGACTGCTCGGGAAGCTGTGGTCAGTGTGTGTGGCCACCTGTACTGTTGGCCATGTCTTCATCAGTGGCTGGAGACACGGCC
  • Show more
Description: A cloning plasmid for the RNF5 gene.
RNF5 cloning plasmid
CSB-CL857879HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: ATGGCAGCAGCGGAGGAGGAGGACGGGGGCCCCGAAGGGCCAAATCGCGAGCGGGGCGGGGCGGGCGCGACCTTCGAATGTAATATATGTTTGGAGACTGCTCGGGAAGCTGTGGTCAGTGTGTGTGGCCACCTGTACTGTTGGCCATGTCTTCATCAGTGGCTGGAGACACGGCC
  • Show more
Description: A cloning plasmid for the RNF5 gene.
RNF5 Blocking Peptide
DF9490-BP 1mg
EUR 195
Human E3 ubiquitin- protein ligase RNF5, RNF5 ELISA KIT
ELI-44970h 96 Tests
EUR 824
Mouse E3 ubiquitin- protein ligase RNF5, Rnf5 ELISA KIT
ELI-41165m 96 Tests
EUR 865
Mouse RNF5 shRNA Plasmid
20-abx974444
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RNF5 shRNA Plasmid
20-abx954095
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RNF5 shRNA Plasmid
20-abx990737
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RNF5 Recombinant Protein (Human)
RP026695 100 ug Ask for price
RNF5 Recombinant Protein (Human)
RP042967 100 ug Ask for price
RNF5 Recombinant Protein (Human)
RP042970 100 ug Ask for price
RNF5 Recombinant Protein (Rat)
RP226460 100 ug Ask for price
pCMV-Flag-RNF5 Plasmid
PVTB00325-2a 2 ug
EUR 356
RNF5 Recombinant Protein (Mouse)
RP168689 100 ug Ask for price
Ring Finger Protein 5 (RNF5) Antibody
20-abx142198
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ring Finger Protein 5 (RNF5) Antibody
abx034022-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ring Finger Protein 5 (RNF5) Antibody
abx034022-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ring Finger Protein 5 (RNF5) Antibody
20-abx006132
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ring Finger Protein 5 (RNF5) Antibody
abx026814-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ring Finger Protein 5 (RNF5) Antibody
abx026814-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ring Finger Protein 5 (RNF5) Antibody
20-abx321987
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ring Finger Protein 5 (RNF5) Antibody
20-abx322617
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ring Finger Protein 5 (RNF5) Antibody
20-abx241993
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ring Finger Protein 5 (RNF5) Antibody
20-abx241994
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RNF5 ORF Vector (Human) (pORF)
ORF008899 1.0 ug DNA
EUR 95
Rnf5 ORF Vector (Mouse) (pORF)
ORF056231 1.0 ug DNA
EUR 506
Rnf5 ORF Vector (Rat) (pORF)
ORF075488 1.0 ug DNA
EUR 506
RNF5 ORF Vector (Human) (pORF)
ORF014323 1.0 ug DNA
EUR 354
RNF5 ORF Vector (Human) (pORF)
ORF014324 1.0 ug DNA
EUR 354
RNF5 sgRNA CRISPR Lentivector set (Human)
K1834001 3 x 1.0 ug
EUR 339
Rnf5 sgRNA CRISPR Lentivector set (Rat)
K7460801 3 x 1.0 ug
EUR 339
Rnf5 sgRNA CRISPR Lentivector set (Mouse)
K4928401 3 x 1.0 ug
EUR 339
RNF5 sgRNA CRISPR Lentivector (Human) (Target 1)
K1834002 1.0 ug DNA
EUR 154
RNF5 sgRNA CRISPR Lentivector (Human) (Target 2)
K1834003 1.0 ug DNA
EUR 154
RNF5 sgRNA CRISPR Lentivector (Human) (Target 3)
K1834004 1.0 ug DNA
EUR 154
Rnf5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7460802 1.0 ug DNA
EUR 154
Rnf5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7460803 1.0 ug DNA
EUR 154
Rnf5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7460804 1.0 ug DNA
EUR 154
Rnf5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4928402 1.0 ug DNA
EUR 154
Rnf5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4928403 1.0 ug DNA
EUR 154
Rnf5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4928404 1.0 ug DNA
EUR 154
RNF5 Protein Vector (Human) (pPB-C-His)
PV057289 500 ng
EUR 481
RNF5 Protein Vector (Human) (pPB-N-His)
PV057290 500 ng
EUR 481
RNF5 Protein Vector (Human) (pPM-C-HA)
PV057291 500 ng
EUR 481
RNF5 Protein Vector (Human) (pPM-C-His)
PV057292 500 ng
EUR 481
RNF5 Protein Vector (Human) (pPB-C-His)
PV057293 500 ng
EUR 481
RNF5 Protein Vector (Human) (pPB-N-His)
PV057294 500 ng
EUR 481
RNF5 Protein Vector (Human) (pPM-C-HA)
PV057295 500 ng
EUR 481
RNF5 Protein Vector (Human) (pPM-C-His)
PV057296 500 ng
EUR 481
RNF5 Protein Vector (Human) (pPB-C-His)
PV035593 500 ng
EUR 329
RNF5 Protein Vector (Human) (pPB-N-His)
PV035594 500 ng
EUR 329
RNF5 Protein Vector (Human) (pPM-C-HA)
PV035595 500 ng
EUR 329
RNF5 Protein Vector (Human) (pPM-C-His)
PV035596 500 ng
EUR 329
RNF5 Protein Vector (Rat) (pPB-C-His)
PV301950 500 ng
EUR 603
RNF5 Protein Vector (Rat) (pPB-N-His)
PV301951 500 ng
EUR 603
RNF5 Protein Vector (Rat) (pPM-C-HA)
PV301952 500 ng
EUR 603

RNF5 Rabbit Polyclonal Antibody