RNF5 Rabbit Polyclonal Antibody

RNF5 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

RNF5 Polyclonal Antibody
ES9635-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RNF5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RNF5 Polyclonal Antibody
ABP60221-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RNF5 protein Applications tips:
Description: A polyclonal antibody for detection of RNF5 from Human, Mouse, Rat. This RNF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF5 protein

RNF5 Polyclonal Antibody
ABP60221-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RNF5 protein Applications tips:
Description: A polyclonal antibody for detection of RNF5 from Human, Mouse, Rat. This RNF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF5 protein

RNF5 Polyclonal Antibody
ABP60221-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RNF5 protein Applications tips:
Description: A polyclonal antibody for detection of RNF5 from Human, Mouse, Rat. This RNF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF5 protein

RNF5 Rabbit pAb
A8351-100ul	Abclonal	100 ul	EUR 308

RNF5 Rabbit pAb
A8351-200ul	Abclonal	200 ul	EUR 459

RNF5 Rabbit pAb
A8351-20ul	Abclonal	20 ul	EUR 183

RNF5 Rabbit pAb
A8351-50ul	Abclonal	50 ul	EUR 223

Polyclonal RNF5 Antibody (Center)
APR03695G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RNF5 (Center). This antibody is tested and proven to work in the following applications:

RNF5 Antibody
ABD9490	Lifescience Market	100 ug	EUR 438

RNF5 antibody
70R-9592	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal RNF5 antibody

RNF5 Antibody
37869-100ul	SAB	100ul	EUR 252

RNF5 Antibody
DF9490	Affbiotech	200ul	EUR 304
Description: RNF5 Antibody detects endogenous levels of total RNF5.

RNF5 Antibody
1-CSB-PA345004	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RNF5 Antibody
1-CSB-PA857879DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

RNF5 Antibody
1-CSB-PA857879DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RNF5 Antibody
1-CSB-PA034142	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RNF5. Recognizes RNF5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

Polyclonal RNF5 Antibody (N-term)
APR11182G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RNF5 (N-term). This antibody is tested and proven to work in the following applications:

Rnf5/ Rat Rnf5 ELISA Kit
ELI-18515r	Lifescience Market	96 Tests	EUR 886

RNF5 Conjugated Antibody
C37869	SAB	100ul	EUR 397

Anti-RNF5 antibody
STJ110649	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene contains a RING finger, which is a motif known to be involved in protein-protein interactions. This protein is a membrane-bound ubiquitin ligase. It can regulate cell motility by targeting paxillin ubiquitination and altering the distribution and localization of paxillin in cytoplasm and cell focal adhesions.

Anti-RNF5 antibody
STJ190793	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RNF5

RNF5 siRNA
20-abx904622	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF5 siRNA
20-abx931802	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF5 siRNA
20-abx931803	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF5 Blocking Peptide
33R-1002	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IRX3 antibody, catalog no. 70R-8548

RNF5 cloning plasmid
CSB-CL857879HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 543 Sequence: atggcagcagcggaggaggaggacgggggccccgaagggccaaatcgcgagcggggcggggcgggcgcgaccttcgaatgtaatatatgtttggagactgctcgggaagctgtggtcagtgtgtgtggccacctgtactgttggccatgtcttcatcagtggctggagacacggcc Show more
Description: A cloning plasmid for the RNF5 gene.

RNF5 cloning plasmid
CSB-CL857879HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 543 Sequence: ATGGCAGCAGCGGAGGAGGAGGACGGGGGCCCCGAAGGGCCAAATCGCGAGCGGGGCGGGGCGGGCGCGACCTTCGAATGTAATATATGTTTGGAGACTGCTCGGGAAGCTGTGGTCAGTGTGTGTGGCCACCTGTACTGTTGGCCATGTCTTCATCAGTGGCTGGAGACACGGCC Show more
Description: A cloning plasmid for the RNF5 gene.

RNF5 cloning plasmid
CSB-CL857879HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 543 Sequence: ATGGCAGCAGCGGAGGAGGAGGACGGGGGCCCCGAAGGGCCAAATCGCGAGCGGGGCGGGGCGGGCGCGACCTTCGAATGTAATATATGTTTGGAGACTGCTCGGGAAGCTGTGGTCAGTGTGTGTGGCCACCTGTACTGTTGGCCATGTCTTCATCAGTGGCTGGAGACACGGCC Show more
Description: A cloning plasmid for the RNF5 gene.

RNF5 Blocking Peptide
DF9490-BP	Affbiotech	1mg	EUR 195

Human E3 ubiquitin- protein ligase RNF5, RNF5 ELISA KIT
ELI-44970h	Lifescience Market	96 Tests	EUR 824

Mouse E3 ubiquitin- protein ligase RNF5, Rnf5 ELISA KIT
ELI-41165m	Lifescience Market	96 Tests	EUR 865

Mouse RNF5 shRNA Plasmid
20-abx974444	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RNF5 shRNA Plasmid
20-abx954095	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RNF5 shRNA Plasmid
20-abx990737	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RNF5 Recombinant Protein (Human)
RP026695	ABM	100 ug	Ask for price

RNF5 Recombinant Protein (Human)
RP042967	ABM	100 ug	Ask for price

RNF5 Recombinant Protein (Human)
RP042970	ABM	100 ug	Ask for price

RNF5 Recombinant Protein (Rat)
RP226460	ABM	100 ug	Ask for price

pCMV-Flag-RNF5 Plasmid
PVTB00325-2a	Lifescience Market	2 ug	EUR 356

RNF5 Recombinant Protein (Mouse)
RP168689	ABM	100 ug	Ask for price

Ring Finger Protein 5 (RNF5) Antibody
20-abx142198	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Ring Finger Protein 5 (RNF5) Antibody
abx034022-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ring Finger Protein 5 (RNF5) Antibody
abx034022-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ring Finger Protein 5 (RNF5) Antibody
20-abx006132	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ring Finger Protein 5 (RNF5) Antibody
abx026814-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ring Finger Protein 5 (RNF5) Antibody
abx026814-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ring Finger Protein 5 (RNF5) Antibody
20-abx321987	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Ring Finger Protein 5 (RNF5) Antibody
20-abx322617	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Ring Finger Protein 5 (RNF5) Antibody
20-abx241993	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ring Finger Protein 5 (RNF5) Antibody
20-abx241994	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RNF5 ORF Vector (Human) (pORF)
ORF008899	ABM	1.0 ug DNA	EUR 95

Rnf5 ORF Vector (Mouse) (pORF)
ORF056231	ABM	1.0 ug DNA	EUR 506

Rnf5 ORF Vector (Rat) (pORF)
ORF075488	ABM	1.0 ug DNA	EUR 506

RNF5 ORF Vector (Human) (pORF)
ORF014323	ABM	1.0 ug DNA	EUR 354

RNF5 ORF Vector (Human) (pORF)
ORF014324	ABM	1.0 ug DNA	EUR 354

RNF5 sgRNA CRISPR Lentivector set (Human)
K1834001	ABM	3 x 1.0 ug	EUR 339

Rnf5 sgRNA CRISPR Lentivector set (Rat)
K7460801	ABM	3 x 1.0 ug	EUR 339

Rnf5 sgRNA CRISPR Lentivector set (Mouse)
K4928401	ABM	3 x 1.0 ug	EUR 339

RNF5 sgRNA CRISPR Lentivector (Human) (Target 1)
K1834002	ABM	1.0 ug DNA	EUR 154

RNF5 sgRNA CRISPR Lentivector (Human) (Target 2)
K1834003	ABM	1.0 ug DNA	EUR 154

RNF5 sgRNA CRISPR Lentivector (Human) (Target 3)
K1834004	ABM	1.0 ug DNA	EUR 154

Rnf5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7460802	ABM	1.0 ug DNA	EUR 154

Rnf5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7460803	ABM	1.0 ug DNA	EUR 154

Rnf5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7460804	ABM	1.0 ug DNA	EUR 154

Rnf5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4928402	ABM	1.0 ug DNA	EUR 154

Rnf5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4928403	ABM	1.0 ug DNA	EUR 154

Rnf5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4928404	ABM	1.0 ug DNA	EUR 154

RNF5 Protein Vector (Human) (pPB-C-His)
PV057289	ABM	500 ng	EUR 481

RNF5 Protein Vector (Human) (pPB-N-His)
PV057290	ABM	500 ng	EUR 481

RNF5 Protein Vector (Human) (pPM-C-HA)
PV057291	ABM	500 ng	EUR 481

RNF5 Protein Vector (Human) (pPM-C-His)
PV057292	ABM	500 ng	EUR 481

RNF5 Protein Vector (Human) (pPB-C-His)
PV057293	ABM	500 ng	EUR 481

RNF5 Protein Vector (Human) (pPB-N-His)
PV057294	ABM	500 ng	EUR 481

RNF5 Protein Vector (Human) (pPM-C-HA)
PV057295	ABM	500 ng	EUR 481

RNF5 Protein Vector (Human) (pPM-C-His)
PV057296	ABM	500 ng	EUR 481

RNF5 Protein Vector (Human) (pPB-C-His)
PV035593	ABM	500 ng	EUR 329

RNF5 Protein Vector (Human) (pPB-N-His)
PV035594	ABM	500 ng	EUR 329

RNF5 Protein Vector (Human) (pPM-C-HA)
PV035595	ABM	500 ng	EUR 329

RNF5 Protein Vector (Human) (pPM-C-His)
PV035596	ABM	500 ng	EUR 329

RNF5 Protein Vector (Rat) (pPB-C-His)
PV301950	ABM	500 ng	EUR 603

RNF5 Protein Vector (Rat) (pPB-N-His)
PV301951	ABM	500 ng	EUR 603

RNF5 Protein Vector (Rat) (pPM-C-HA)
PV301952	ABM	500 ng	EUR 603

RNF5 Rabbit Polyclonal Antibody