SAR1A Rabbit Polyclonal Antibody
SAR1A Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
SAR1A Polyclonal Antibody |
ABP60324-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SAR1A protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SAR1A from Human, Mouse. This SAR1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SAR1A protein |
SAR1A Polyclonal Antibody |
ABP60324-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SAR1A protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SAR1A from Human, Mouse. This SAR1A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SAR1A protein |
SAR1A Rabbit pAb |
A7476-100ul |
Abclonal |
100 ul |
EUR 308 |
SAR1A Rabbit pAb |
A7476-200ul |
Abclonal |
200 ul |
EUR 459 |
SAR1A Rabbit pAb |
A7476-20ul |
Abclonal |
20 ul |
EUR 183 |
SAR1A Rabbit pAb |
A7476-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal SAR1A Antibody (Center) |
AMM07709G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAR1A (Center). This antibody is tested and proven to work in the following applications: |
Rabbit GTP binding protein SAR1a(SAR1A) ELISA kit |
E04G0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit GTP binding protein SAR1a(SAR1A) ELISA kit |
E04G0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit GTP binding protein SAR1a(SAR1A) ELISA kit |
E04G0457-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
SAR1A Antibody |
AF4630 |
Affbiotech |
200ul |
EUR 376 |
Description: SAR1A Antibody detects endogenous levels of SAR1A. |
SAR1A Antibody |
46001-100ul |
SAB |
100ul |
EUR 252 |
SAR1A Antibody |
46001-50ul |
SAB |
50ul |
EUR 187 |
SAR1A antibody |
70R-20084 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SAR1A antibody |
SAR1A Antibody |
DF9554 |
Affbiotech |
200ul |
EUR 304 |
Description: SAR1A Antibody detects endogenous levels of total SAR1A. |
SAR1A Antibody |
1-CSB-PA873630ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SAR1A. Recognizes SAR1A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
SAR1A Antibody |
1-CSB-PA020702GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SAR1A. Recognizes SAR1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal SAR1A / SAR1 Antibody (Internal) |
AMM07725G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SAR1A / SAR1 (Internal). This antibody is tested and proven to work in the following applications: |
SAR1A Conjugated Antibody |
C46001 |
SAB |
100ul |
EUR 397 |
anti- SAR1A antibody |
FNab07601 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: SAR1 homolog A(S. cerevisiae)
- Uniprot ID: Q9NR31
- Gene ID: 56681
- Research Area: Signal Transduction
|
Description: Antibody raised against SAR1A |
anti- SAR1A antibody |
FNab07602 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: SAR1 homolog A(S. cerevisiae)
- Uniprot ID: Q9NR31
- Gene ID: 56681
- Research Area: Signal Transduction
|
Description: Antibody raised against SAR1A |
Anti-SAR1A antibody |
STJ190853 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SAR1A |
Human GTP-binding protein SAR1a (SAR1A) |
1-CSB-EP873630HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 49.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human GTP-binding protein SAR1a(SAR1A) expressed in E.coli |
SAR1A siRNA |
20-abx932460 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-SAR1A(Thr139) Antibody |
AF4330 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-SAR1A(Thr139) Antibody detects endogenous levels of SAR1A only when phosphorylated at Thr139. |
Goat GTP binding protein SAR1a(SAR1A) ELISA kit |
E06G0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat GTP binding protein SAR1a(SAR1A) ELISA kit |
E06G0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat GTP binding protein SAR1a(SAR1A) ELISA kit |
E06G0457-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat GTP binding protein SAR1a(SAR1A) ELISA kit |
E02G0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat GTP binding protein SAR1a(SAR1A) ELISA kit |
E02G0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat GTP binding protein SAR1a(SAR1A) ELISA kit |
E02G0457-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse GTP binding protein SAR1a(SAR1A) ELISA kit |
E03G0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse GTP binding protein SAR1a(SAR1A) ELISA kit |
E03G0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse GTP binding protein SAR1a(SAR1A) ELISA kit |
E03G0457-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human GTP binding protein SAR1a(SAR1A) ELISA kit |
E01G0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human GTP binding protein SAR1a(SAR1A) ELISA kit |
E01G0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human GTP binding protein SAR1a(SAR1A) ELISA kit |
E01G0457-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog GTP binding protein SAR1a(SAR1A) ELISA kit |
E08G0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog GTP binding protein SAR1a(SAR1A) ELISA kit |
E08G0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog GTP binding protein SAR1a(SAR1A) ELISA kit |
E08G0457-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig GTP binding protein SAR1a(SAR1A) ELISA kit |
E07G0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig GTP binding protein SAR1a(SAR1A) ELISA kit |
E07G0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig GTP binding protein SAR1a(SAR1A) ELISA kit |
E07G0457-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey GTP binding protein SAR1a(SAR1A) ELISA kit |
E09G0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey GTP binding protein SAR1a(SAR1A) ELISA kit |
E09G0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey GTP binding protein SAR1a(SAR1A) ELISA kit |
E09G0457-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Bovine GTP- binding protein SAR1a, SAR1A ELISA KIT |
ELI-18887b |
Lifescience Market |
96 Tests |
EUR 928 |
Human GTP- binding protein SAR1a, SAR1A ELISA KIT |
ELI-53188h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse GTP- binding protein SAR1a, Sar1a ELISA KIT |
ELI-53189m |
Lifescience Market |
96 Tests |
EUR 865 |
Porcine GTP- binding protein SAR1a, SAR1A ELISA KIT |
ELI-29538p |
Lifescience Market |
96 Tests |
EUR 928 |
SAR1A Blocking Peptide |
AF4630-BP |
Affbiotech |
1mg |
EUR 195 |
SAR1A cloning plasmid |
CSB-CL873630HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 597
- Sequence: atgtctttcatctttgagtggatctacaatggcttcagcagtgtgctccagttcctaggactgtacaagaaatctggaaaacttgtattcttaggtttggataatgcaggcaaaaccactcttcttcacatgctcaaagatgacagattgggccaacatgttccaacactacatcc
- Show more
|
Description: A cloning plasmid for the SAR1A gene. |
SAR1A Blocking Peptide |
DF9554-BP |
Affbiotech |
1mg |
EUR 195 |
Guinea pig GTP binding protein SAR1a(SAR1A) ELISA kit |
E05G0457-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig GTP binding protein SAR1a(SAR1A) ELISA kit |
E05G0457-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig GTP binding protein SAR1a(SAR1A) ELISA kit |
E05G0457-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
SAR1A protein (His tag) |
80R-1168 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human SAR1A protein |
Human SAR1A shRNA Plasmid |
20-abx961173 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SAR1A Recombinant Protein (Human) |
RP027598 |
ABM |
100 ug |
Ask for price |
SAR1A Recombinant Protein (Rat) |
RP227465 |
ABM |
100 ug |
Ask for price |
SAR1A Recombinant Protein (Mouse) |
RP169991 |
ABM |
100 ug |
Ask for price |
Monoclonal SAR1A Antibody (monoclonal) (M01), Clone: 3G5 |
AMM07710G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human SAR1A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3G5. This antibody is applicable in WB |
Phospho-SAR1A(Thr139) Blocking Peptide |
AF4330-BP |
Affbiotech |
1mg |
EUR 195 |
GTP-Binding Protein SAR1A Protein |
20-abx261446 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
SAR1A ORF Vector (Human) (pORF) |
ORF009200 |
ABM |
1.0 ug DNA |
EUR 95 |
Sar1a ORF Vector (Mouse) (pORF) |
ORF056665 |
ABM |
1.0 ug DNA |
EUR 506 |
Sar1a ORF Vector (Rat) (pORF) |
ORF075823 |
ABM |
1.0 ug DNA |
EUR 506 |
Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody |
abx033062-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody |
abx033062-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody |
20-abx006980 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody |
20-abx322470 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody |
20-abx218438 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody |
abx237601-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody |
abx237602-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Recombinant Human GTP-Binding Protein SAR1A |
7-06319 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human GTP-Binding Protein SAR1A |
7-06320 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human GTP-Binding Protein SAR1A |
7-06321 |
CHI Scientific |
1mg |
Ask for price |
SAR1A sgRNA CRISPR Lentivector set (Human) |
K2089001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sar1a sgRNA CRISPR Lentivector set (Mouse) |
K3392401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sar1a sgRNA CRISPR Lentivector set (Rat) |
K7359201 |
ABM |
3 x 1.0 ug |
EUR 339 |
SAR1A sgRNA CRISPR Lentivector (Human) (Target 1) |
K2089002 |
ABM |
1.0 ug DNA |
EUR 154 |
SAR1A sgRNA CRISPR Lentivector (Human) (Target 2) |
K2089003 |
ABM |
1.0 ug DNA |
EUR 154 |
SAR1A sgRNA CRISPR Lentivector (Human) (Target 3) |
K2089004 |
ABM |
1.0 ug DNA |
EUR 154 |
Sar1a sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3392402 |
ABM |
1.0 ug DNA |
EUR 154 |
Sar1a sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3392403 |
ABM |
1.0 ug DNA |
EUR 154 |
Sar1a sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3392404 |
ABM |
1.0 ug DNA |
EUR 154 |
Sar1a sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7359202 |
ABM |
1.0 ug DNA |
EUR 154 |
Sar1a sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7359203 |
ABM |
1.0 ug DNA |
EUR 154 |
Sar1a sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7359204 |
ABM |
1.0 ug DNA |
EUR 154 |
GTP-Binding Protein SAR1A Human Recombinant Protein |
PROTQ9NR31 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: SAR1A Human Recombinant fused with 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 218 amino acids (1- 198 a.a.) and having a molecular mass of 24.5kDa.;The SAR1A is purified by proprietary chromatographic techniques. |
SAR1A Protein Vector (Human) (pPB-C-His) |
PV036797 |
ABM |
500 ng |
EUR 329 |
SAR1A Protein Vector (Human) (pPB-N-His) |
PV036798 |
ABM |
500 ng |
EUR 329 |
SAR1A Protein Vector (Human) (pPM-C-HA) |
PV036799 |
ABM |
500 ng |
EUR 329 |
SAR1A Protein Vector (Human) (pPM-C-His) |
PV036800 |
ABM |
500 ng |
EUR 329 |
SAR1A Protein Vector (Rat) (pPB-C-His) |
PV303290 |
ABM |
500 ng |
EUR 603 |
SAR1A Protein Vector (Rat) (pPB-N-His) |
PV303291 |
ABM |
500 ng |
EUR 603 |
SAR1A Protein Vector (Rat) (pPM-C-HA) |
PV303292 |
ABM |
500 ng |
EUR 603 |
SAR1A Protein Vector (Rat) (pPM-C-His) |
PV303293 |
ABM |
500 ng |
EUR 603 |
SAR1A Protein Vector (Mouse) (pPB-C-His) |
PV226658 |
ABM |
500 ng |
EUR 603 |
SAR1A Protein Vector (Mouse) (pPB-N-His) |
PV226659 |
ABM |
500 ng |
EUR 603 |
SAR1A Protein Vector (Mouse) (pPM-C-HA) |
PV226660 |
ABM |
500 ng |
EUR 603 |
SAR1A Protein Vector (Mouse) (pPM-C-His) |
PV226661 |
ABM |
500 ng |
EUR 603 |
Sar1a 3'UTR GFP Stable Cell Line |
TU168345 |
ABM |
1.0 ml |
Ask for price |
SAR1A 3'UTR Luciferase Stable Cell Line |
TU022587 |
ABM |
1.0 ml |
EUR 1521 |
Sar1a 3'UTR Luciferase Stable Cell Line |
TU118345 |
ABM |
1.0 ml |
Ask for price |
SAR1A 3'UTR GFP Stable Cell Line |
TU072587 |
ABM |
1.0 ml |
EUR 1521 |
Sar1a 3'UTR Luciferase Stable Cell Line |
TU219915 |
ABM |
1.0 ml |
Ask for price |
Sar1a 3'UTR GFP Stable Cell Line |
TU269915 |
ABM |
1.0 ml |
Ask for price |
SAR1A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV634099 |
ABM |
1.0 ug DNA |
EUR 514 |
SAR1A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV634103 |
ABM |
1.0 ug DNA |
EUR 514 |
SAR1A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV634104 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
SAR1A Rabbit Polyclonal Antibody