UBR2 Rabbit Polyclonal Antibody
UBR2 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
UBR2 Polyclonal Antibody |
ES9638-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against UBR2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
UBR2 Polyclonal Antibody |
ES9638-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against UBR2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Polyclonal UBR2 Antibody (Internal) |
APG01236G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBR2 (Internal). This antibody is tested and proven to work in the following applications: |
UBR2 antibody |
70R-21131 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UBR2 antibody |
UBR2 antibody |
70R-2651 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal UBR2 antibody raised against the C terminal of UBR2 |
UBR2 Antibody |
43611-100ul |
SAB |
100ul |
EUR 252 |
UBR2 Antibody |
1-CSB-PA809001LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
UBR2 Antibody |
DF9491 |
Affbiotech |
200ul |
EUR 304 |
Description: UBR2 Antibody detects endogenous levels of total UBR2. |
UBR2 antibody |
70R-51368 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal UBR2 antibody |
UBR2 Antibody |
1-CSB-PA025517GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
Polyclonal UBR2 Antibody (internal region) |
APG00619G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBR2 (internal region). This antibody is tested and proven to work in the following applications: |
UBR2 Polyclonal Antibody, HRP Conjugated |
A66031 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
UBR2 Polyclonal Antibody, FITC Conjugated |
A66032 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
UBR2 Polyclonal Antibody, Biotin Conjugated |
A66033 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody |
20-abx007789 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody |
20-abx116419 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody |
abx239209-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody |
20-abx318610 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody |
abx431716-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Anti-UBR2 Antibody |
A05812-2 |
BosterBio |
100ug/vial |
EUR 334 |
UBR2 Conjugated Antibody |
C43611 |
SAB |
100ul |
EUR 397 |
anti- UBR2 antibody |
FNab09209 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:200-1:2000
- IF:1:10-1:100
- IHC: 1:20-1:200
- Immunogen: ubiquitin protein ligase E3 component n-recognin 2
- Uniprot ID: Q8IWV8
- Gene ID: 23304
- Research Area: Epigenetics, Metabolism, Developmental biology
|
Description: Antibody raised against UBR2 |
Anti-UBR2 antibody |
STJ190796 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UBR2 |
E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody (HRP) |
20-abx308490 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody (FITC) |
20-abx308491 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody (Biotin) |
20-abx308492 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
UBR2 siRNA |
20-abx938870 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBR2 siRNA |
20-abx938871 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-UBR2 |
YF-PA17829 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to UBR2 |
anti-UBR2 |
YF-PA17830 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to UBR2 |
anti-UBR2 |
YF-PA25864 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to UBR2 |
UBR2 Antibody, HRP conjugated |
1-CSB-PA809001LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UBR2 Antibody, FITC conjugated |
1-CSB-PA809001LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UBR2 Antibody, Biotin conjugated |
1-CSB-PA809001LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
UBR2 Blocking Peptide |
33R-7566 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBR2 antibody, catalog no. 70R-2651 |
UBR2 Blocking Peptide |
DF9491-BP |
Affbiotech |
1mg |
EUR 195 |
UBR2 Blocking Peptide |
20-abx064243 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBR2 cloning plasmid |
CSB-CL809001HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1320
- Sequence: atggcgtcggagctagagccagaggtgcaggccatcgaccggagcttgctggaatgttcggccgaggagattgcggggaaatggctgcaagcaactgacctcactagagaagtgtaccagcatttagcccactatgtacccaaaatctactgcaggggtcccaacccttttccac
- Show more
|
Description: A cloning plasmid for the UBR2 gene. |
Anti-UBR2 (4G4) |
YF-MA17840 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to UBR2 |
Anti-UBR2 (4G4) |
YF-MA17841 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to UBR2 |
Human E3 Ubiquitin-Protein Ligase UBR2 (UBR2) ELISA Kit |
abx384097-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human E3 ubiquitin- protein ligase UBR2, UBR2 ELISA KIT |
ELI-39986h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse E3 ubiquitin- protein ligase UBR2, Ubr2 ELISA KIT |
ELI-39987m |
Lifescience Market |
96 Tests |
EUR 865 |
Human UBR2 shRNA Plasmid |
20-abx958164 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse UBR2 shRNA Plasmid |
20-abx981364 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal UBR2 Antibody (monoclonal) (M01), Clone: 4G4 |
AMM04289G |
Leading Biology |
0.05mg |
EUR 659 |
Description: A Monoclonal antibody against Human UBR2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4G4. This antibody is applicable in WB and IF, E |
Ubr2 ORF Vector (Mouse) (pORF) |
ORF060947 |
ABM |
1.0 ug DNA |
EUR 1572 |
Ubr2 ORF Vector (Mouse) (pORF) |
ORF060948 |
ABM |
1.0 ug DNA |
EUR 1572 |
Ubr2 ORF Vector (Rat) (pORF) |
ORF078557 |
ABM |
1.0 ug DNA |
EUR 2080 |
UBR2 ORF Vector (Human) (pORF) |
ORF011275 |
ABM |
1.0 ug DNA |
EUR 95 |
Ubr2 sgRNA CRISPR Lentivector set (Rat) |
K6245901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ubr2 sgRNA CRISPR Lentivector set (Mouse) |
K4275701 |
ABM |
3 x 1.0 ug |
EUR 339 |
UBR2 sgRNA CRISPR Lentivector set (Human) |
K2578301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ubr2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6245902 |
ABM |
1.0 ug DNA |
EUR 154 |
Ubr2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6245903 |
ABM |
1.0 ug DNA |
EUR 154 |
Ubr2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6245904 |
ABM |
1.0 ug DNA |
EUR 154 |
Ubr2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4275702 |
ABM |
1.0 ug DNA |
EUR 154 |
Ubr2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4275703 |
ABM |
1.0 ug DNA |
EUR 154 |
Ubr2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4275704 |
ABM |
1.0 ug DNA |
EUR 154 |
UBR2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2578302 |
ABM |
1.0 ug DNA |
EUR 154 |
UBR2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2578303 |
ABM |
1.0 ug DNA |
EUR 154 |
UBR2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2578304 |
ABM |
1.0 ug DNA |
EUR 154 |
UBR2 Protein Vector (Mouse) (pPB-C-His) |
PV243786 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Mouse) (pPB-N-His) |
PV243787 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Mouse) (pPM-C-HA) |
PV243788 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Mouse) (pPM-C-His) |
PV243789 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Mouse) (pPB-C-His) |
PV243790 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Mouse) (pPB-N-His) |
PV243791 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Mouse) (pPM-C-HA) |
PV243792 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Mouse) (pPM-C-His) |
PV243793 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Rat) (pPB-C-His) |
PV314226 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Rat) (pPB-N-His) |
PV314227 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Rat) (pPM-C-HA) |
PV314228 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Rat) (pPM-C-His) |
PV314229 |
ABM |
500 ng |
EUR 2926 |
UBR2 Protein Vector (Human) (pPB-C-His) |
PV045097 |
ABM |
500 ng |
EUR 329 |
UBR2 Protein Vector (Human) (pPB-N-His) |
PV045098 |
ABM |
500 ng |
EUR 329 |
UBR2 Protein Vector (Human) (pPM-C-HA) |
PV045099 |
ABM |
500 ng |
EUR 329 |
UBR2 Protein Vector (Human) (pPM-C-His) |
PV045100 |
ABM |
500 ng |
EUR 329 |
Ubr2 3'UTR Luciferase Stable Cell Line |
TU121503 |
ABM |
1.0 ml |
Ask for price |
UBR2 3'UTR GFP Stable Cell Line |
TU077728 |
ABM |
1.0 ml |
EUR 1521 |
Ubr2 3'UTR GFP Stable Cell Line |
TU171503 |
ABM |
1.0 ml |
Ask for price |
Ubr2 3'UTR Luciferase Stable Cell Line |
TU222791 |
ABM |
1.0 ml |
Ask for price |
UBR2 Rabbit Polyclonal Antibody