UBR2 Rabbit Polyclonal Antibody

UBR2 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

UBR2 Polyclonal Antibody
ES9638-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against UBR2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

UBR2 Polyclonal Antibody
ES9638-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against UBR2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal UBR2 Antibody (Internal)
APG01236G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBR2 (Internal). This antibody is tested and proven to work in the following applications:

UBR2 antibody
70R-21131	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UBR2 antibody

UBR2 antibody
70R-2651	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal UBR2 antibody raised against the C terminal of UBR2

UBR2 Antibody
43611-100ul	SAB	100ul	EUR 252

UBR2 Antibody
1-CSB-PA809001LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

UBR2 Antibody
DF9491	Affbiotech	200ul	EUR 304
Description: UBR2 Antibody detects endogenous levels of total UBR2.

UBR2 antibody
70R-51368	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal UBR2 antibody

UBR2 Antibody
1-CSB-PA025517GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

UBR2 Antibody
ABD9491	Lifescience Market	100 ug	EUR 438

Polyclonal UBR2 Antibody (internal region)
APG00619G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBR2 (internal region). This antibody is tested and proven to work in the following applications:

UBR2 Polyclonal Antibody, HRP Conjugated
A66031	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

UBR2 Polyclonal Antibody, FITC Conjugated
A66032	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

UBR2 Polyclonal Antibody, Biotin Conjugated
A66033	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody
20-abx007789	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody
20-abx116419	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody
abx239209-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody
20-abx318610	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody
abx431716-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Anti-UBR2 Antibody
A05812-2	BosterBio	100ug/vial	EUR 334

UBR2 Conjugated Antibody
C43611	SAB	100ul	EUR 397

anti- UBR2 antibody
FNab09209	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200-1:2000 IF：1：10-1:100 IHC: 1:20-1:200 Immunogen: ubiquitin protein ligase E3 component n-recognin 2 Uniprot ID: Q8IWV8 Gene ID: 23304 Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against UBR2

Anti-UBR2 antibody
PAab09209	Lifescience Market	100 ug	EUR 412

Anti-UBR2 antibody
STJ72039	St John's Laboratory	100 µg	EUR 359

Anti-UBR2 antibody
STJ190796	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to UBR2

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody (HRP)
20-abx308490	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody (FITC)
20-abx308491	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody (Biotin)
20-abx308492	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

UBR2 siRNA
20-abx938870	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBR2 siRNA
20-abx938871	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-UBR2
YF-PA17829	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to UBR2

anti-UBR2
YF-PA17830	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to UBR2

anti-UBR2
YF-PA25864	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to UBR2

UBR2 Antibody, HRP conjugated
1-CSB-PA809001LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBR2 Antibody, FITC conjugated
1-CSB-PA809001LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBR2 Antibody, Biotin conjugated
1-CSB-PA809001LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UBR2 Blocking Peptide
33R-7566	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBR2 antibody, catalog no. 70R-2651

UBR2 Blocking Peptide
DF9491-BP	Affbiotech	1mg	EUR 195

UBR2 Blocking Peptide
20-abx064243	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

UBR2 cloning plasmid
CSB-CL809001HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1320 Sequence: atggcgtcggagctagagccagaggtgcaggccatcgaccggagcttgctggaatgttcggccgaggagattgcggggaaatggctgcaagcaactgacctcactagagaagtgtaccagcatttagcccactatgtacccaaaatctactgcaggggtcccaacccttttccac Show more
Description: A cloning plasmid for the UBR2 gene.

Anti-UBR2 (4G4)
YF-MA17840	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to UBR2

Anti-UBR2 (4G4)
YF-MA17841	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to UBR2

Human E3 Ubiquitin-Protein Ligase UBR2 (UBR2) ELISA Kit
abx384097-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human E3 ubiquitin- protein ligase UBR2, UBR2 ELISA KIT
ELI-39986h	Lifescience Market	96 Tests	EUR 824

Mouse E3 ubiquitin- protein ligase UBR2, Ubr2 ELISA KIT
ELI-39987m	Lifescience Market	96 Tests	EUR 865

UBR2 ELISA KIT|Human
EF004034	Lifescience Market	96 Tests	EUR 689

Human UBR2 shRNA Plasmid
20-abx958164	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse UBR2 shRNA Plasmid
20-abx981364	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Monoclonal UBR2 Antibody (monoclonal) (M01), Clone: 4G4
AMM04289G	Leading Biology	0.05mg	EUR 659
Description: A Monoclonal antibody against Human UBR2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4G4. This antibody is applicable in WB and IF, E

Ubr2 ORF Vector (Mouse) (pORF)
ORF060947	ABM	1.0 ug DNA	EUR 1572

Ubr2 ORF Vector (Mouse) (pORF)
ORF060948	ABM	1.0 ug DNA	EUR 1572

Ubr2 ORF Vector (Rat) (pORF)
ORF078557	ABM	1.0 ug DNA	EUR 2080

UBR2 ORF Vector (Human) (pORF)
ORF011275	ABM	1.0 ug DNA	EUR 95

Ubr2 sgRNA CRISPR Lentivector set (Rat)
K6245901	ABM	3 x 1.0 ug	EUR 339

Ubr2 sgRNA CRISPR Lentivector set (Mouse)
K4275701	ABM	3 x 1.0 ug	EUR 339

UBR2 sgRNA CRISPR Lentivector set (Human)
K2578301	ABM	3 x 1.0 ug	EUR 339

Ubr2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6245902	ABM	1.0 ug DNA	EUR 154

Ubr2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6245903	ABM	1.0 ug DNA	EUR 154

Ubr2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6245904	ABM	1.0 ug DNA	EUR 154

Ubr2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4275702	ABM	1.0 ug DNA	EUR 154

Ubr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4275703	ABM	1.0 ug DNA	EUR 154

Ubr2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4275704	ABM	1.0 ug DNA	EUR 154

UBR2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2578302	ABM	1.0 ug DNA	EUR 154

UBR2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2578303	ABM	1.0 ug DNA	EUR 154

UBR2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2578304	ABM	1.0 ug DNA	EUR 154

UBR2 Protein Vector (Mouse) (pPB-C-His)
PV243786	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Mouse) (pPB-N-His)
PV243787	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Mouse) (pPM-C-HA)
PV243788	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Mouse) (pPM-C-His)
PV243789	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Mouse) (pPB-C-His)
PV243790	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Mouse) (pPB-N-His)
PV243791	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Mouse) (pPM-C-HA)
PV243792	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Mouse) (pPM-C-His)
PV243793	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Rat) (pPB-C-His)
PV314226	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Rat) (pPB-N-His)
PV314227	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Rat) (pPM-C-HA)
PV314228	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Rat) (pPM-C-His)
PV314229	ABM	500 ng	EUR 2926

UBR2 Protein Vector (Human) (pPB-C-His)
PV045097	ABM	500 ng	EUR 329

UBR2 Protein Vector (Human) (pPB-N-His)
PV045098	ABM	500 ng	EUR 329

UBR2 Protein Vector (Human) (pPM-C-HA)
PV045099	ABM	500 ng	EUR 329

UBR2 Protein Vector (Human) (pPM-C-His)
PV045100	ABM	500 ng	EUR 329

Ubr2 3'UTR Luciferase Stable Cell Line
TU121503	ABM	1.0 ml	Ask for price

UBR2 3'UTR GFP Stable Cell Line
TU077728	ABM	1.0 ml	EUR 1521

Ubr2 3'UTR GFP Stable Cell Line
TU171503	ABM	1.0 ml	Ask for price

Ubr2 3'UTR Luciferase Stable Cell Line
TU222791	ABM	1.0 ml	Ask for price

UBR2 Rabbit Polyclonal Antibody