ZNRF1 Rabbit Polyclonal Antibody

ZNRF1 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ZNRF1 Polyclonal Antibody
ES9639-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZNRF1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
ZNRF1 Polyclonal Antibody
ABP60990-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ZNRF1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ZNRF1 from Human, Mouse. This ZNRF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZNRF1 protein
ZNRF1 Polyclonal Antibody
ABP60990-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ZNRF1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ZNRF1 from Human, Mouse. This ZNRF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZNRF1 protein
ZNRF1 Polyclonal Antibody
ABP60990-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ZNRF1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ZNRF1 from Human, Mouse. This ZNRF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZNRF1 protein
ZNRF1 Rabbit pAb
A15918-100ul 100 ul
EUR 308
ZNRF1 Rabbit pAb
A15918-200ul 200 ul
EUR 459
ZNRF1 Rabbit pAb
A15918-20ul 20 ul
EUR 183
ZNRF1 Rabbit pAb
A15918-50ul 50 ul
EUR 223
ZNRF1 Antibody
ABD9492 100 ug
EUR 438
ZNRF1 antibody
70R-8389 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZNRF1 antibody
ZNRF1 Antibody
45964-100ul 100ul
EUR 252
ZNRF1 Antibody
45964-50ul 50ul
EUR 187
ZNRF1 Antibody
DF9492 200ul
EUR 304
Description: ZNRF1 Antibody detects endogenous levels of total ZNRF1.
Polyclonal ZNRF1 (mouse) Antibody (internal region)
APG00831G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ZNRF1 (mouse) (internal region). This antibody is tested and proven to work in the following applications:
ZNRF1 Conjugated Antibody
C45964 100ul
EUR 397
Anti-ZNRF1 antibody
STJ118377 100 µl
EUR 277
Anti-ZNRF1 antibody
STJ190797 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZNRF1
ZNRF1 siRNA
20-abx941177
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ZNRF1 siRNA
20-abx941178
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ZNRF1
YF-PA21527 50 ul
EUR 363
Description: Mouse polyclonal to ZNRF1
anti-ZNRF1
YF-PA21528 50 ug
EUR 363
Description: Mouse polyclonal to ZNRF1
anti-ZNRF1
YF-PA26755 50 ul
EUR 334
Description: Mouse polyclonal to ZNRF1
Anti-ZNRF1 (mouse) antibody
STJ72828 100 µg
EUR 359
ZNRF1 Blocking Peptide
33R-6033 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZNRF1 antibody, catalog no. 70R-8389
ZNRF1 Blocking Peptide
DF9492-BP 1mg
EUR 195
ZNRF1 cloning plasmid
CSB-CL839856HU-10ug 10ug
EUR 301
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atggggggcaagcagagcacggcggcccgctcccggggccccttcccgggggtctccaccgatgacagcgccgtgccgccgccgggaggggcgccccatttcgggcactaccggacgggcggcggggccatggggctgcgcagccgctcggtcagctcggtggcaggcatgggcat
  • Show more
Description: A cloning plasmid for the ZNRF1 gene.
Anti-ZNRF1 (1H4)
YF-MA11705 100 ug
EUR 363
Description: Mouse monoclonal to ZNRF1
Mouse E3 ubiquitin- protein ligase ZNRF1, Znrf1 ELISA KIT
ELI-17685m 96 Tests
EUR 865
Human E3 ubiquitin- protein ligase ZNRF1, ZNRF1 ELISA KIT
ELI-51182h 96 Tests
EUR 824
Mouse ZNRF1 shRNA Plasmid
20-abx980319
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ZNRF1 shRNA Plasmid
20-abx963707
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ZNRF1 Recombinant Protein (Human)
RP036283 100 ug Ask for price
ZNRF1 Recombinant Protein (Mouse)
RP188240 100 ug Ask for price
ZNRF1 Recombinant Protein (Mouse)
RP188243 100 ug Ask for price
ZNRF1 Recombinant Protein (Mouse)
RP188246 100 ug Ask for price
ZNRF1 Recombinant Protein (Mouse)
RP188249 100 ug Ask for price
Zinc/RING Finger Protein 1 (ZNRF1) Antibody
abx029041-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Zinc/RING Finger Protein 1 (ZNRF1) Antibody
abx029041-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Zinc/RING Finger Protein 1 (ZNRF1) Antibody
20-abx219476
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Zinc/RING Finger Protein 1 (ZNRF1) Antibody
abx431405-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
ZNRF1 ORF Vector (Human) (pORF)
ORF012095 1.0 ug DNA
EUR 95
Znrf1 ORF Vector (Mouse) (pORF)
ORF062748 1.0 ug DNA
EUR 506
Znrf1 ORF Vector (Mouse) (pORF)
ORF062749 1.0 ug DNA
EUR 506
Znrf1 ORF Vector (Mouse) (pORF)
ORF062750 1.0 ug DNA
EUR 506
Znrf1 ORF Vector (Mouse) (pORF)
ORF062751 1.0 ug DNA
EUR 506
ZNRF1 sgRNA CRISPR Lentivector set (Human)
K2739501 3 x 1.0 ug
EUR 339
Znrf1 sgRNA CRISPR Lentivector set (Mouse)
K4786601 3 x 1.0 ug
EUR 339
ZNRF1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2739502 1.0 ug DNA
EUR 154
ZNRF1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2739503 1.0 ug DNA
EUR 154
ZNRF1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2739504 1.0 ug DNA
EUR 154
Znrf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4786602 1.0 ug DNA
EUR 154
Znrf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4786603 1.0 ug DNA
EUR 154
Znrf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4786604 1.0 ug DNA
EUR 154
ZNRF1 Protein Vector (Human) (pPB-C-His)
PV048377 500 ng
EUR 329
ZNRF1 Protein Vector (Human) (pPB-N-His)
PV048378 500 ng
EUR 329
ZNRF1 Protein Vector (Human) (pPM-C-HA)
PV048379 500 ng
EUR 329
ZNRF1 Protein Vector (Human) (pPM-C-His)
PV048380 500 ng
EUR 329
ZNRF1 Protein Vector (Mouse) (pPB-C-His)
PV250990 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPB-N-His)
PV250991 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPM-C-HA)
PV250992 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPM-C-His)
PV250993 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPB-C-His)
PV250994 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPB-N-His)
PV250995 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPM-C-HA)
PV250996 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPM-C-His)
PV250997 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPB-C-His)
PV250998 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPB-N-His)
PV250999 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPM-C-HA)
PV251000 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPM-C-His)
PV251001 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPB-C-His)
PV251002 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPB-N-His)
PV251003 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPM-C-HA)
PV251004 500 ng
EUR 603
ZNRF1 Protein Vector (Mouse) (pPM-C-His)
PV251005 500 ng
EUR 603
Znrf1 3'UTR GFP Stable Cell Line
TU173014 1.0 ml Ask for price
Znrf1 3'UTR Luciferase Stable Cell Line
TU123014 1.0 ml Ask for price
ZNRF1 3'UTR GFP Stable Cell Line
TU079534 1.0 ml
EUR 2333
ZNRF1 3'UTR Luciferase Stable Cell Line
TU029534 1.0 ml
EUR 2333
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ZNRF1 Rabbit Polyclonal Antibody