AAMP Rabbit Polyclonal Antibody

AAMP Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

AAMP Polyclonal Antibody
30439-50ul 50ul
EUR 187
AAMP Polyclonal Antibody
ABP57639-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AAMP protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of AAMP from Human . This AAMP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AAMP protein at amino acid sequence of 330-410
AAMP Polyclonal Antibody
ABP57639-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AAMP protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of AAMP from Human . This AAMP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AAMP protein at amino acid sequence of 330-410
AAMP Polyclonal Antibody
ABP57639-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AAMP protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of AAMP from Human . This AAMP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AAMP protein at amino acid sequence of 330-410
AAMP Polyclonal Antibody
ES9389-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AAMP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
AAMP Polyclonal Antibody
ES9389-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AAMP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
AAMP Rabbit pAb
A3283-100ul 100 ul
EUR 308
AAMP Rabbit pAb
A3283-200ul 200 ul
EUR 459
AAMP Rabbit pAb
A3283-20ul 20 ul
EUR 183
AAMP Rabbit pAb
A3283-50ul 50 ul
EUR 223
AAMP Polyclonal Conjugated Antibody
C30439 100ul
EUR 397
AAMP antibody
70R-15495 50 ul
EUR 435
Description: Rabbit polyclonal AAMP antibody
AAMP Antibody
39243-100ul 100ul
EUR 390
AAMP Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AAMP. Recognizes AAMP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
AAMP Antibody
DF9207 200ul
EUR 304
Description: AAMP Antibody detects endogenous levels of total AAMP.
AAMP antibody
70R-49321 100 ul
EUR 244
Description: Purified Polyclonal AAMP antibody
AAMP Antibody
ABD9207 100 ug
EUR 438
Polyclonal AAMP antibody - middle region
APR01588G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AAMP - middle region. This antibody is tested and proven to work in the following applications:
anti- AAMP antibody
FNab00019 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:10000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: angio-associated, migratory cell protein
  • Uniprot ID: Q13685
  • Gene ID: 14
  • Research Area: Immunology, Cardiovascular, Developmental biology
Description: Antibody raised against AAMP
Anti-AAMP antibody
PAab00019 100 ug
EUR 355
Anti-AAMP Antibody
PB9123 100ug/vial
EUR 334
Anti-AAMP antibody
STJ26228 100 µl
EUR 277
Description: The gene is a member of the immunoglobulin superfamily. The encoded protein is associated with angiogenesis, with potential roles in endothelial tube formation and the migration of endothelial cells. It may also regulate smooth muscle cell migration via the RhoA pathway. The encoded protein can bind to heparin and may mediate heparin-sensitive cell adhesion.
Anti-AAMP antibody
STJ190547 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AAMP
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AAMP Blocking Peptide
DF9207-BP 1mg
EUR 195
AAMP Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
AAMP cloning plasmid
CSB-CL615711HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: atggaagatgtggactttgaggaagaagaggaggaagagggcaacgaagagggctgggttctagaaccccaggaaggggtggtcggcagcatggagggccccgacgatagcgaggtcacctttgcattgcactcagcatctgtgttttgtgtgagcctggaccccaagaccaata
  • Show more
Description: A cloning plasmid for the AAMP gene.
PVT14307 2 ug
EUR 495
Anti-AAMP (2H2)
YF-MA11790 100 ug
EUR 363
Description: Mouse monoclonal to AAMP
ELI-12194d 96 Tests
EUR 928
EF007516 96 Tests
EUR 689
Human AAMP shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
AAMP Recombinant Protein (Human)
RP000034 100 ug Ask for price
AAMP Recombinant Protein (Mouse)
RP113189 100 ug Ask for price
AAMP Recombinant Protein (Mouse)
RP113192 100 ug Ask for price
AAMP Recombinant Protein (Rat)
RP188471 100 ug Ask for price
Rabbit Angio associated migory cell protein(AAMP) ELISA kit
E04A1120-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Angio associated migory cell protein(AAMP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Angio associated migory cell protein(AAMP) ELISA kit
E04A1120-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Angio associated migory cell protein(AAMP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Angio associated migory cell protein(AAMP) ELISA kit
E04A1120-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Angio associated migory cell protein(AAMP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Angio Associated Migratory Cell Protein (AAMP) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Angio Associated Migratory Cell Protein (AAMP) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Angio Associated Migratory Cell Protein (AAMP) Antibody
abx037787-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Angio Associated Migratory Cell Protein (AAMP) Antibody
abx230019-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Angio Associated Migratory Cell Protein (AAMP) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Aamp ORF Vector (Rat) (pORF)
ORF062825 1.0 ug DNA
EUR 506
AAMP ORF Vector (Human) (pORF)
ORF000012 1.0 ug DNA
EUR 95
Aamp ORF Vector (Mouse) (pORF)
ORF037731 1.0 ug DNA
EUR 506
Aamp ORF Vector (Mouse) (pORF)
ORF037732 1.0 ug DNA
EUR 506
AAMP ELISA Kit (Human) (OKCA00612)
OKCA00612 96 Wells
EUR 833
Description: Description of target: Plays a role in angiogenesis and cell migration. In smooth muscle cell migration, may act through the RhoA pathway.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL
Aamp sgRNA CRISPR Lentivector set (Rat)
K6420701 3 x 1.0 ug
EUR 339
AAMP sgRNA CRISPR Lentivector set (Human)
K0015401 3 x 1.0 ug
EUR 339
Aamp sgRNA CRISPR Lentivector set (Mouse)
K4144101 3 x 1.0 ug
EUR 339
Aamp sgRNA CRISPR Lentivector (Rat) (Target 1)
K6420702 1.0 ug DNA
EUR 154
Aamp sgRNA CRISPR Lentivector (Rat) (Target 2)
K6420703 1.0 ug DNA
EUR 154
Aamp sgRNA CRISPR Lentivector (Rat) (Target 3)
K6420704 1.0 ug DNA
EUR 154
AAMP sgRNA CRISPR Lentivector (Human) (Target 1)
K0015402 1.0 ug DNA
EUR 154
AAMP sgRNA CRISPR Lentivector (Human) (Target 2)
K0015403 1.0 ug DNA
EUR 154
AAMP sgRNA CRISPR Lentivector (Human) (Target 3)
K0015404 1.0 ug DNA
EUR 154
Aamp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4144102 1.0 ug DNA
EUR 154
Aamp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4144103 1.0 ug DNA
EUR 154
Aamp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4144104 1.0 ug DNA
EUR 154
AAMP Protein Vector (Human) (pPB-C-His)
PV000045 500 ng
EUR 329
AAMP Protein Vector (Human) (pPB-N-His)
PV000046 500 ng
EUR 329
AAMP Protein Vector (Human) (pPM-C-HA)
PV000047 500 ng
EUR 329
AAMP Protein Vector (Human) (pPM-C-His)
PV000048 500 ng
EUR 329
AAMP Protein Vector (Mouse) (pPB-C-His)
PV150922 500 ng
EUR 603
AAMP Protein Vector (Mouse) (pPB-N-His)
PV150923 500 ng
EUR 603
AAMP Protein Vector (Mouse) (pPM-C-HA)
PV150924 500 ng
EUR 603
AAMP Protein Vector (Mouse) (pPM-C-His)
PV150925 500 ng
EUR 603
AAMP Protein Vector (Mouse) (pPB-C-His)
PV150926 500 ng
EUR 603
AAMP Protein Vector (Mouse) (pPB-N-His)
PV150927 500 ng
EUR 603

AAMP Rabbit Polyclonal Antibody