ABCA3 Rabbit Polyclonal Antibody

ABCA3 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ABCA3 Polyclonal Antibody

ABP57646-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ABCA3 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of ABCA3 from Human, Mouse. This ABCA3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA3 protein at amino acid sequence of 450-530

ABCA3 Polyclonal Antibody

ABP57646-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABCA3 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of ABCA3 from Human, Mouse. This ABCA3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA3 protein at amino acid sequence of 450-530

ABCA3 Rabbit pAb

A6862-100ul 100 ul
EUR 308

ABCA3 Rabbit pAb

A6862-200ul 200 ul
EUR 459

ABCA3 Rabbit pAb

A6862-20ul 20 ul
EUR 183

ABCA3 Rabbit pAb

A6862-50ul 50 ul
EUR 223

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit

DLR-ABCA3-Hu-48T 48T
EUR 517
  • Should the Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A3 (ABCA3) in samples from tissue homogenates or other biological fluids.

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit

DLR-ABCA3-Hu-96T 96T
EUR 673
  • Should the Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A3 (ABCA3) in samples from tissue homogenates or other biological fluids.

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit

RD-ABCA3-Hu-48Tests 48 Tests
EUR 521

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit

RD-ABCA3-Hu-96Tests 96 Tests
EUR 723

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit

RDR-ABCA3-Hu-48Tests 48 Tests
EUR 544

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit

RDR-ABCA3-Hu-96Tests 96 Tests
EUR 756

ABCA3 Antibody

ABD9245 100 ug
EUR 438

ABCA3 Antibody

45789-100ul 100ul
EUR 252

ABCA3 Antibody

45789-50ul 50ul
EUR 187

ABCA3 Antibody

DF9245 200ul
EUR 304
Description: ABCA3 Antibody detects endogenous levels of total ABCA3.

ABCA3 Antibody

1-CSB-PA859942ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ABCA3. Recognizes ABCA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ABCA3 Conjugated Antibody

C45789 100ul
EUR 397

Anti-ABCA3 antibody

STJ28942 100 µl
EUR 277
Description: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death.

Anti-ABCA3 antibody

STJ190577 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCA3

ABCA3 siRNA

20-abx906288
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCA3 siRNA

20-abx906289
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCA3 cloning plasmid

CSB-CL859942HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 630
  • Sequence: atggctgtgctcaggcagctggcgctcctcctctggaagaactacaccctgcagaagcggaaggtcctggtgacggtcctggaactcttcctgccattgctgttttctgggatcctcatctggctccgcttgaagattcagtcggaaaatgtgcccaacgccaccatctacccggg
  • Show more
Description: A cloning plasmid for the ABCA3 gene.

ABCA3 Blocking Peptide

DF9245-BP 1mg
EUR 195

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human)

4-PAD619Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3)

Mouse ABCA3 shRNA Plasmid

20-abx973911
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABCA3 ELISA KIT

ELI-12192h 96 Tests
EUR 824

Mouse Abca3 ELISA KIT

ELI-49889m 96 Tests
EUR 865

Human ABCA3 shRNA Plasmid

20-abx950013
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), APC

4-PAD619Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with APC.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), Biotinylated

4-PAD619Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), Cy3

4-PAD619Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), FITC

4-PAD619Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), HRP

4-PAD619Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), PE

4-PAD619Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with PE.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), APC-Cy7

4-PAD619Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody

20-abx128628
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody

20-abx147857
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody

abx038096-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody

20-abx005231
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody

20-abx320813
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody

20-abx171345
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anti-P180 Lamellar Body Protein/ABCA3 Antibody

PA2259 100ug/vial
EUR 294

ABCA3 ORF Vector (Human) (pORF)

ORF000022 1.0 ug DNA
EUR 95

Abca3 ORF Vector (Mouse) (pORF)

ORF037757 1.0 ug DNA
EUR 1572

Abca3 ORF Vector (Mouse) (pORF)

ORF037758 1.0 ug DNA
EUR 1572

ABCA3 ELISA Kit (Human) (OKCD01207)

OKCD01207 96 Wells
EUR 831
Description: Description of target: Plays an important role in the formation of pulmonary surfactant, probably by transporting lipids such as cholesterol. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 33 pg/mL

ABCA3 sgRNA CRISPR Lentivector set (Human)

K0016801 3 x 1.0 ug
EUR 339

Abca3 sgRNA CRISPR Lentivector set (Mouse)

K4342901 3 x 1.0 ug
EUR 339

Rabbit ATP binding cassette sub family A member 3(ABCA3) ELISA kit

E04A1130-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 3(ABCA3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family A member 3(ABCA3) ELISA kit

E04A1130-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 3(ABCA3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family A member 3(ABCA3) ELISA kit

E04A1130-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 3(ABCA3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ABCA3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0016802 1.0 ug DNA
EUR 154

ABCA3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0016803 1.0 ug DNA
EUR 154

ABCA3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0016804 1.0 ug DNA
EUR 154

Abca3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4342902 1.0 ug DNA
EUR 154

Abca3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4342903 1.0 ug DNA
EUR 154

Abca3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4342904 1.0 ug DNA
EUR 154

ABCA3 Protein Vector (Human) (pPB-C-His)

PV000085 500 ng
EUR 329

ABCA3 Protein Vector (Human) (pPB-N-His)

PV000086 500 ng
EUR 329

ABCA3 Protein Vector (Human) (pPM-C-HA)

PV000087 500 ng
EUR 329

ABCA3 Protein Vector (Human) (pPM-C-His)

PV000088 500 ng
EUR 329

Recombinant ATP Binding Cassette Transporter A3 (ABCA3)

4-RPD619Hu01
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99758
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.4kDa
  • Isoelectric Point: 8.5
Description: Recombinant Human ATP Binding Cassette Transporter A3 expressed in: E.coli

ABCA3 Protein Vector (Human) (pPB-His-MBP)

PV318666 500 ng
EUR 329

ABCA3 Protein Vector (Human) (pPB-His-GST)

PV318667 500 ng
EUR 329

ABCA3 Protein Vector (Mouse) (pPB-C-His)

PV151026 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPB-N-His)

PV151027 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPM-C-HA)

PV151028 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPM-C-His)

PV151029 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPB-C-His)

PV151030 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPB-N-His)

PV151031 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPM-C-HA)

PV151032 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPM-C-His)

PV151033 500 ng
EUR 2848

Abca3 3'UTR Luciferase Stable Cell Line

TU200039 1.0 ml Ask for price

Abca3 3'UTR GFP Stable Cell Line

TU151136 1.0 ml Ask for price

ABCA3 3'UTR Luciferase Stable Cell Line

TU000036 1.0 ml
EUR 4617

Abca3 3'UTR Luciferase Stable Cell Line

TU101136 1.0 ml Ask for price

ABCA3 3'UTR GFP Stable Cell Line

TU050036 1.0 ml
EUR 4617

Abca3 3'UTR GFP Stable Cell Line

TU250039 1.0 ml Ask for price

Human ATP Binding Cassette Transporter A3 (ABCA3) Protein

20-abx167134
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ABCA3 Rabbit Polyclonal Antibody