ABCC9 Rabbit Polyclonal Antibody

ABCC9 Rabbit Polyclonal Antibody

Order Now:

ABCC9 Polyclonal Antibody

ABP57656-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ABCC9 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of ABCC9 from Human. This ABCC9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCC9 protein at amino acid sequence of 30-110

ABCC9 Polyclonal Antibody

ABP57656-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABCC9 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of ABCC9 from Human. This ABCC9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCC9 protein at amino acid sequence of 30-110

Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit

DLR-ABCC9-Hu-48T 48T
EUR 517
  • Should the Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter C9 (ABCC9) in samples from tissue homogenates, cell lysates or other biological fluids.

Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit

DLR-ABCC9-Hu-96T 96T
EUR 673
  • Should the Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter C9 (ABCC9) in samples from tissue homogenates, cell lysates or other biological fluids.

Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit

RD-ABCC9-Hu-48Tests 48 Tests
EUR 521

Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit

RD-ABCC9-Hu-96Tests 96 Tests
EUR 723

Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit

RDR-ABCC9-Hu-48Tests 48 Tests
EUR 544

Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit

RDR-ABCC9-Hu-96Tests 96 Tests
EUR 756

ABCC9 Antibody

ABD9255 100 ug
EUR 438

ABCC9 antibody

70R-6250 50 ug
EUR 467
Description: Rabbit polyclonal ABCC9 antibody

ABCC9 Antibody

40229-100ul 100ul
EUR 252

ABCC9 Antibody

DF9255 200ul
EUR 304
Description: ABCC9 Antibody detects endogenous levels of total ABCC9.

ABCC9 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:40-1:150

ABCC9 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ABCC9 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Polyclonal ABCC9 / SUR2 Antibody (internal region)

APG01426G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCC9 / SUR2 (internal region). This antibody is tested and proven to work in the following applications:

ABCC9 Conjugated Antibody

C40229 100ul
EUR 397

Anti-ABCC9 antibody

STJ190589 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCC9

Abcc9/ Rat Abcc9 ELISA Kit

ELI-49469r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCC9 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ABCC9 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ABCC9 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-ABCC9 / SUR2 antibody

STJ72728 100 µg
EUR 260

ABCC9 Blocking Peptide

33R-1620 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABCC9 antibody, catalog no. 70R-6250

ABCC9 Blocking Peptide

DF9255-BP 1mg
EUR 195

ABCC9 cloning plasmid

CSB-CL001067HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 450
  • Sequence: atgagcctttcattttgtggtaacaacatttcttcatataatatcaacgatggtgtactacaaaattcctgctttgtggatgccctcaacctggtccctcatgtctttctgttgtttatcacttttccaatattgtttattgggtgggggagccaaagctcaaaagtacaaattca
  • Show more
Description: A cloning plasmid for the ABCC9 gene.

Rat ABCC9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Abcc9 ELISA KIT

ELI-12146m 96 Tests
EUR 865


ELI-35144h 96 Tests
EUR 824

Human ABCC9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ABCC9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody

abx147871-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody

abx030224-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody

abx030224-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody

abx430474-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

ABCC9 ORF Vector (Human) (pORF)

ORF000030 1.0 ug DNA
EUR 95

Abcc9 ORF Vector (Mouse) (pORF)

ORF037791 1.0 ug DNA
EUR 1572

Abcc9 ORF Vector (Mouse) (pORF)

ORF037792 1.0 ug DNA
EUR 1572

Abcc9 ORF Vector (Mouse) (pORF)

ORF037793 1.0 ug DNA
EUR 1572

Abcc9 ORF Vector (Mouse) (pORF)

ORF037794 1.0 ug DNA
EUR 1572

Abcc9 ORF Vector (Rat) (pORF)

ORF062862 1.0 ug DNA
EUR 2080

ABCC9 ELISA Kit (Human) (OKCD01777)

OKCD01777 96 Wells
EUR 831
Description: Description of target: Subunit of ATP-sensitive potassium channels (KATP). Can form cardiac and smooth muscle-type KATP channels with KCNJ11. KCNJ11 forms the channel pore while ABCC9 is required for activation and regulation.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.132 ng/mL

ATP Binding Cassette Transporter C9 (ABCC9) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter C9 (ABCC9) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit ATP- binding cassette sub- family C member 9, ABCC9 ELISA

ELI-12229Ra 96 Tests
EUR 928

ABCC9 sgRNA CRISPR Lentivector set (Human)

K0019901 3 x 1.0 ug
EUR 339

Abcc9 sgRNA CRISPR Lentivector set (Mouse)

K3931201 3 x 1.0 ug
EUR 339

Abcc9 sgRNA CRISPR Lentivector set (Rat)

K6900401 3 x 1.0 ug
EUR 339

Rabbit ATP binding cassette sub family C member 9(ABCC9) ELISA kit

E04A1144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family C member 9(ABCC9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family C member 9(ABCC9) ELISA kit

E04A1144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family C member 9(ABCC9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family C member 9(ABCC9) ELISA kit

E04A1144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family C member 9(ABCC9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ABCC9 sgRNA CRISPR Lentivector (Human) (Target 1)

K0019902 1.0 ug DNA
EUR 154

ABCC9 sgRNA CRISPR Lentivector (Human) (Target 2)

K0019903 1.0 ug DNA
EUR 154

ABCC9 sgRNA CRISPR Lentivector (Human) (Target 3)

K0019904 1.0 ug DNA
EUR 154

Abcc9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3931202 1.0 ug DNA
EUR 154

Abcc9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3931203 1.0 ug DNA
EUR 154

Abcc9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3931204 1.0 ug DNA
EUR 154

ABCC9 Protein Vector (Human) (pPB-C-His)

PV000117 500 ng
EUR 329

ABCC9 Protein Vector (Human) (pPB-N-His)

PV000118 500 ng
EUR 329

ABCC9 Protein Vector (Human) (pPM-C-HA)

PV000119 500 ng
EUR 329

ABCC9 Protein Vector (Human) (pPM-C-His)

PV000120 500 ng
EUR 329

Abcc9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6900402 1.0 ug DNA
EUR 154

Abcc9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6900403 1.0 ug DNA
EUR 154

Abcc9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6900404 1.0 ug DNA
EUR 154

ABCC9 Protein Vector (Human) (pPB-His-MBP)

PV318806 500 ng
EUR 329

ABCC9 Protein Vector (Human) (pPB-His-GST)

PV318807 500 ng
EUR 329

ABCC9 Protein Vector (Mouse) (pPB-C-His)

PV151162 500 ng
EUR 2608

ABCC9 Protein Vector (Mouse) (pPB-N-His)

PV151163 500 ng
EUR 2608

ABCC9 Protein Vector (Mouse) (pPM-C-HA)

PV151164 500 ng
EUR 2608

ABCC9 Protein Vector (Mouse) (pPM-C-His)

PV151165 500 ng
EUR 2608

ABCC9 Protein Vector (Mouse) (pPB-C-His)

PV151166 500 ng
EUR 2555

ABCC9 Protein Vector (Mouse) (pPB-N-His)

PV151167 500 ng
EUR 2555

ABCC9 Protein Vector (Mouse) (pPM-C-HA)

PV151168 500 ng
EUR 2555

ABCC9 Protein Vector (Mouse) (pPM-C-His)

PV151169 500 ng
EUR 2555

ABCC9 Protein Vector (Mouse) (pPB-C-His)

PV151170 500 ng
EUR 2608

ABCC9 Protein Vector (Mouse) (pPB-N-His)

PV151171 500 ng
EUR 2608

ABCC9 Protein Vector (Mouse) (pPM-C-HA)

PV151172 500 ng
EUR 2608

ABCC9 Protein Vector (Mouse) (pPM-C-His)

PV151173 500 ng
EUR 2608

ABCC9 Protein Vector (Mouse) (pPB-C-His)

PV151174 500 ng
EUR 2588

ABCC9 Protein Vector (Mouse) (pPB-N-His)

PV151175 500 ng
EUR 2588

ABCC9 Protein Vector (Mouse) (pPM-C-HA)

PV151176 500 ng
EUR 2588

ABCC9 Protein Vector (Mouse) (pPM-C-His)

PV151177 500 ng
EUR 2588

ABCC9 Protein Vector (Rat) (pPB-C-His)

PV251446 500 ng
EUR 2606

ABCC9 Protein Vector (Rat) (pPB-N-His)

PV251447 500 ng
EUR 2606

ABCC9 Protein Vector (Rat) (pPM-C-HA)

PV251448 500 ng
EUR 2606

ABCC9 Protein Vector (Rat) (pPM-C-His)

PV251449 500 ng
EUR 2606

Abcc9 3'UTR Luciferase Stable Cell Line

TU200066 1.0 ml Ask for price

Abcc9 3'UTR GFP Stable Cell Line

TU151163 1.0 ml Ask for price

ABCC9 3'UTR Luciferase Stable Cell Line

TU000070 1.0 ml
EUR 2333

Abcc9 3'UTR Luciferase Stable Cell Line

TU101163 1.0 ml Ask for price

ABCC9 3'UTR GFP Stable Cell Line

TU050070 1.0 ml
EUR 2333

Abcc9 3'UTR GFP Stable Cell Line

TU250066 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

ABCC9 Rabbit Polyclonal Antibody