ABCF3 Rabbit Polyclonal Antibody

ABCF3 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ABCF3 Polyclonal Antibody
ABP57660-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ABCF3 from Human, Mouse, Rat. This ABCF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120

ABCF3 Polyclonal Antibody
ABP57660-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ABCF3 from Human, Mouse, Rat. This ABCF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120

ABCF3 Polyclonal Antibody
ES9426-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ABCF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCF3 Polyclonal Antibody
ES9426-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ABCF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCF3 Rabbit pAb
A15168-100ul 100 ul
EUR 308

ABCF3 Rabbit pAb
A15168-200ul 200 ul
EUR 459

ABCF3 Rabbit pAb
A15168-20ul 20 ul
EUR 183

ABCF3 Rabbit pAb
A15168-50ul 50 ul
EUR 223

ABCF3 Antibody
36005-100ul 100ul
EUR 252

ABCF3 Antibody
1-CSB-PA595084
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ABCF3 Antibody
1-CSB-PA889115LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ABCF3 Antibody
1-CSB-PA781903
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ABCF3 Antibody
DF9251 200ul
EUR 304
Description: ABCF3 Antibody detects endogenous levels of total ABCF3.

ABCF3 antibody
70R-51386 100 ul
EUR 244
Description: Purified Polyclonal ABCF3 antibody

ABCF3 antibody
70R-6278 50 ug
EUR 467
Description: Rabbit polyclonal ABCF3 antibody

ABCF3 Antibody
ABD9251 100 ug
EUR 438

Polyclonal ABCF3 Antibody (internal region)
APG00557G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCF3 (internal region). This antibody is tested and proven to work in the following applications:

ABCF3 Polyclonal Antibody, Biotin Conjugated
A57935 100 µg
EUR 570.55
Description: kits suitable for this type of research

ABCF3 Polyclonal Antibody, FITC Conjugated
A57936 100 µg
EUR 570.55
Description: fast delivery possible

ABCF3 Polyclonal Antibody, HRP Conjugated
A57937 100 µg
EUR 570.55
Description: reagents widely cited

ABCF3 Conjugated Antibody
C36005 100ul
EUR 397

Anti-ABCF3 antibody
STJ117362 100 µl
EUR 277
Description: This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding cassette proteins transport various molecules across extra- and intracellular membranes. The protein encoded by this gene displays antiviral effect against flaviviruses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-ABCF3 antibody
STJ71646 100 µg
EUR 260

Anti-ABCF3 antibody
STJ190584 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCF3

Abcf3/ Rat Abcf3 ELISA Kit
ELI-24553r 96 Tests
EUR 886

ABCF3 siRNA
20-abx900077
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCF3 siRNA
20-abx906355
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCF3 siRNA
20-abx906356
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ABCF3
YF-PA19690 50 ul
EUR 363
Description: Mouse polyclonal to ABCF3

ABCF3 Antibody, HRP conjugated
1-CSB-PA889115LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ABCF3 Antibody, FITC conjugated
1-CSB-PA889115LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ABCF3 Antibody, Biotin conjugated
1-CSB-PA889115LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ABCF3 Blocking Peptide
33R-1883 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABCF3 antibody, catalog no. 70R-6278

ABCF3 Blocking Peptide
DF9251-BP 1mg
EUR 195

ABCF3 Blocking Peptide
20-abx064261
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ABCF3 cloning plasmid
CSB-CL889115HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2130
  • Sequence: atggcgacttgcgccgaaatcctgcggagcgagttccccgaaattgacggacaagtcttcgactacgtgaccggcgtcttgcacagcggcagcgcggacttcgagtctgtggatgacctggtggaagctgtaggggaactattgcaagaggtgtccggggacagcaaggatgacg
  • Show more
Description: A cloning plasmid for the ABCF3 gene.

ABCF3 cloning plasmid
CSB-CL889115HU2-10ug 10ug
EUR 706
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2130
  • Sequence: atggcgacttgcgccgaaatcctgcggagcgagttccccgaaattgacggacaagtcttcgactacgtgaccggcgtcttgcacagcggcagcgcggacttcgagtctgtggatgacctggtggaagctgtaggggaactattgcaagaggtgtccggggacagcaaggatgacg
  • Show more
Description: A cloning plasmid for the ABCF3 gene.

pCMV-SPORT6-ABCF3
PVT14355 2 ug
EUR 495

Rat ABCF3 shRNA Plasmid
20-abx988292
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ABCF3 shRNA Plasmid
20-abx973908
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABCF3 shRNA Plasmid
20-abx960655
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABCF3 ELISA KIT
ELI-34877h 96 Tests
EUR 824

Mouse Abcf3 ELISA KIT
ELI-49471m 96 Tests
EUR 865

ABCF3 Recombinant Protein (Human)
RP000106 100 ug Ask for price

ABCF3 Recombinant Protein (Human)
RP000109 100 ug Ask for price

ABCF3 Recombinant Protein (Mouse)
RP113405 100 ug Ask for price

ABCF3 Recombinant Protein (Rat)
RP188606 100 ug Ask for price

Abcf3 ORF Vector (Rat) (pORF)
ORF062870 1.0 ug DNA
EUR 506

ABCF3 ORF Vector (Human) (pORF)
ORF000036 1.0 ug DNA
EUR 95

ABCF3 ORF Vector (Human) (pORF)
ORF000037 1.0 ug DNA
EUR 95

Abcf3 ORF Vector (Mouse) (pORF)
ORF037803 1.0 ug DNA
EUR 506

Abcf3 sgRNA CRISPR Lentivector set (Rat)
K6246001 3 x 1.0 ug
EUR 339

Abcf3 sgRNA CRISPR Lentivector set (Mouse)
K3532401 3 x 1.0 ug
EUR 339

ABCF3 sgRNA CRISPR Lentivector set (Human)
K0021501 3 x 1.0 ug
EUR 339

Rabbit ATP binding cassette sub family F member 3(ABCF3) ELISA kit
E04A1152-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family F member 3(ABCF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family F member 3(ABCF3) ELISA kit
E04A1152-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family F member 3(ABCF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family F member 3(ABCF3) ELISA kit
E04A1152-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family F member 3(ABCF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody
20-abx007772
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody
abx038087-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody
abx038088-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody
20-abx241169
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody
20-abx241170
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody
abx431873-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody
20-abx301739
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Abcf3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6246002 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6246003 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6246004 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3532402 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3532403 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3532404 1.0 ug DNA
EUR 154

ABCF3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0021502 1.0 ug DNA
EUR 154

ABCF3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0021503 1.0 ug DNA
EUR 154

ABCF3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0021504 1.0 ug DNA
EUR 154

ABCF3 Protein Vector (Mouse) (pPB-C-His)
PV151210 500 ng
EUR 1065

ABCF3 Protein Vector (Mouse) (pPB-N-His)
PV151211 500 ng
EUR 1065

ABCF3 Protein Vector (Mouse) (pPM-C-HA)
PV151212 500 ng
EUR 1065

ABCF3 Protein Vector (Mouse) (pPM-C-His)
PV151213 500 ng
EUR 1065

ABCF3 Protein Vector (Rat) (pPB-C-His)
PV251478 500 ng
EUR 1166

ABCF3 Protein Vector (Rat) (pPB-N-His)
PV251479 500 ng
EUR 1166

ABCF3 Protein Vector (Rat) (pPM-C-HA)
PV251480 500 ng
EUR 1166

ABCF3 Protein Vector (Rat) (pPM-C-His)
PV251481 500 ng
EUR 1166

ABCF3 Protein Vector (Human) (pPB-His-MBP)
PV318862 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-His-GST)
PV318863 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-His-MBP)
PV318866 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-His-GST)
PV318867 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-C-His)
PV000141 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-N-His)
PV000142 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPM-C-HA)
PV000143 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPM-C-His)
PV000144 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-C-His)
PV000145 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-N-His)
PV000146 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPM-C-HA)
PV000147 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPM-C-His)
PV000148 500 ng
EUR 329

Abcf3 3'UTR Luciferase Stable Cell Line
TU101171 1.0 ml Ask for price

Abcf3 3'UTR GFP Stable Cell Line
TU151171 1.0 ml Ask for price

Abcf3 3'UTR Luciferase Stable Cell Line
TU200074 1.0 ml Ask for price

Abcf3 3'UTR GFP Stable Cell Line
TU250074 1.0 ml Ask for price

ABCF3 3'UTR GFP Stable Cell Line
TU050086 1.0 ml
EUR 1394

ABCF3 3'UTR Luciferase Stable Cell Line
TU000086 1.0 ml
EUR 1394

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody (HRP)
20-abx312080
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody (FITC)
20-abx312081
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody (Biotin)
20-abx312082
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ABCF3 Rabbit Polyclonal Antibody

Site Title, Some rights reserved.

Terms of Use - Privacy Policy

WordPress Di Business Theme