ABCF3 Rabbit Polyclonal Antibody

ABCF3 Rabbit Polyclonal Antibody

Order Now:

ABCF3 Polyclonal Antibody

ABP57660-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ABCF3 from Human, Mouse, Rat. This ABCF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120

ABCF3 Polyclonal Antibody

ABP57660-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ABCF3 from Human, Mouse, Rat. This ABCF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120

ABCF3 Polyclonal Antibody

ABP57660-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ABCF3 from Human, Mouse, Rat. This ABCF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120

ABCF3 Polyclonal Antibody

A57934 100 µg
EUR 570.55
Description: The best epigenetics products

ABCF3 Rabbit pAb

A15168-100ul 100 ul
EUR 308

ABCF3 Rabbit pAb

A15168-200ul 200 ul
EUR 459

ABCF3 Rabbit pAb

A15168-20ul 20 ul
EUR 183

ABCF3 Rabbit pAb

A15168-50ul 50 ul
EUR 223

ABCF3 Antibody

ABD9251 100 ug
EUR 438

ABCF3 antibody

70R-51386 100 ul
EUR 244
Description: Purified Polyclonal ABCF3 antibody

ABCF3 antibody

70R-6278 50 ug
EUR 467
Description: Rabbit polyclonal ABCF3 antibody

ABCF3 Antibody

36005-100ul 100ul
EUR 252

ABCF3 Antibody

DF9251 200ul
EUR 304
Description: ABCF3 Antibody detects endogenous levels of total ABCF3.

ABCF3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ABCF3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ABCF3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Polyclonal ABCF3 Antibody (internal region)

APG00557G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCF3 (internal region). This antibody is tested and proven to work in the following applications:

ABCF3 Polyclonal Antibody, Biotin Conjugated

A57935 100 µg
EUR 570.55
Description: kits suitable for this type of research

ABCF3 Polyclonal Antibody, FITC Conjugated

A57936 100 µg
EUR 570.55
Description: fast delivery possible

ABCF3 Polyclonal Antibody, HRP Conjugated

A57937 100 µg
EUR 570.55
Description: reagents widely cited

ABCF3 Conjugated Antibody

C36005 100ul
EUR 397

Anti-ABCF3 antibody

STJ71646 100 µg
EUR 260

Anti-ABCF3 antibody

STJ117362 100 µl
EUR 277
Description: This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding cassette proteins transport various molecules across extra- and intracellular membranes. The protein encoded by this gene displays antiviral effect against flaviviruses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-ABCF3 antibody

STJ190584 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCF3

Abcf3/ Rat Abcf3 ELISA Kit

ELI-24553r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19690 50 ul
EUR 363
Description: Mouse polyclonal to ABCF3

ABCF3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ABCF3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ABCF3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ABCF3 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ABCF3 Blocking Peptide

33R-1883 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABCF3 antibody, catalog no. 70R-6278

ABCF3 Blocking Peptide

DF9251-BP 1mg
EUR 195

ABCF3 cloning plasmid

CSB-CL889115HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2130
  • Sequence: atggcgacttgcgccgaaatcctgcggagcgagttccccgaaattgacggacaagtcttcgactacgtgaccggcgtcttgcacagcggcagcgcggacttcgagtctgtggatgacctggtggaagctgtaggggaactattgcaagaggtgtccggggacagcaaggatgacg
  • Show more
Description: A cloning plasmid for the ABCF3 gene.

ABCF3 cloning plasmid

CSB-CL889115HU2-10ug 10ug
EUR 706
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2130
  • Sequence: atggcgacttgcgccgaaatcctgcggagcgagttccccgaaattgacggacaagtcttcgactacgtgaccggcgtcttgcacagcggcagcgcggacttcgagtctgtggatgacctggtggaagctgtaggggaactattgcaagaggtgtccggggacagcaaggatgacg
  • Show more
Description: A cloning plasmid for the ABCF3 gene.


PVT14355 2 ug
EUR 495

Mouse ABCF3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ABCF3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-34877h 96 Tests
EUR 824

Mouse Abcf3 ELISA KIT

ELI-49471m 96 Tests
EUR 865

Human ABCF3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ABCF3 Recombinant Protein (Human)

RP000106 100 ug Ask for price

ABCF3 Recombinant Protein (Human)

RP000109 100 ug Ask for price

ABCF3 Recombinant Protein (Rat)

RP188606 100 ug Ask for price

ABCF3 Recombinant Protein (Mouse)

RP113405 100 ug Ask for price

ABCF3 ORF Vector (Human) (pORF)

ORF000036 1.0 ug DNA
EUR 95

ABCF3 ORF Vector (Human) (pORF)

ORF000037 1.0 ug DNA
EUR 95

Abcf3 ORF Vector (Mouse) (pORF)

ORF037803 1.0 ug DNA
EUR 506

Abcf3 ORF Vector (Rat) (pORF)

ORF062870 1.0 ug DNA
EUR 506

ABCF3 sgRNA CRISPR Lentivector set (Human)

K0021501 3 x 1.0 ug
EUR 339

Abcf3 sgRNA CRISPR Lentivector set (Rat)

K6246001 3 x 1.0 ug
EUR 339

Abcf3 sgRNA CRISPR Lentivector set (Mouse)

K3532401 3 x 1.0 ug
EUR 339

Rabbit ATP binding cassette sub family F member 3(ABCF3) ELISA kit

E04A1152-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family F member 3(ABCF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family F member 3(ABCF3) ELISA kit

E04A1152-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family F member 3(ABCF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family F member 3(ABCF3) ELISA kit

E04A1152-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family F member 3(ABCF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody

abx038087-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody

abx038088-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody

abx431873-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ABCF3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0021502 1.0 ug DNA
EUR 154

ABCF3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0021503 1.0 ug DNA
EUR 154

ABCF3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0021504 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6246002 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6246003 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6246004 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3532402 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3532403 1.0 ug DNA
EUR 154

Abcf3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3532404 1.0 ug DNA
EUR 154

ABCF3 Protein Vector (Human) (pPB-C-His)

PV000141 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-N-His)

PV000142 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPM-C-HA)

PV000143 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPM-C-His)

PV000144 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-C-His)

PV000145 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-N-His)

PV000146 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPM-C-HA)

PV000147 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPM-C-His)

PV000148 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-His-MBP)

PV318862 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-His-GST)

PV318863 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-His-MBP)

PV318866 500 ng
EUR 329

ABCF3 Protein Vector (Human) (pPB-His-GST)

PV318867 500 ng
EUR 329

ABCF3 Protein Vector (Mouse) (pPB-C-His)

PV151210 500 ng
EUR 1065

ABCF3 Protein Vector (Mouse) (pPB-N-His)

PV151211 500 ng
EUR 1065

ABCF3 Protein Vector (Mouse) (pPM-C-HA)

PV151212 500 ng
EUR 1065

ABCF3 Protein Vector (Mouse) (pPM-C-His)

PV151213 500 ng
EUR 1065

ABCF3 Protein Vector (Rat) (pPB-C-His)

PV251478 500 ng
EUR 1166

ABCF3 Protein Vector (Rat) (pPB-N-His)

PV251479 500 ng
EUR 1166

ABCF3 Protein Vector (Rat) (pPM-C-HA)

PV251480 500 ng
EUR 1166

ABCF3 Protein Vector (Rat) (pPM-C-His)

PV251481 500 ng
EUR 1166

Abcf3 3'UTR Luciferase Stable Cell Line

TU200074 1.0 ml Ask for price

Abcf3 3'UTR GFP Stable Cell Line

TU151171 1.0 ml Ask for price

ABCF3 3'UTR Luciferase Stable Cell Line

TU000086 1.0 ml
EUR 1394

Abcf3 3'UTR Luciferase Stable Cell Line

TU101171 1.0 ml Ask for price

ABCF3 3'UTR GFP Stable Cell Line

TU050086 1.0 ml
EUR 1394

Abcf3 3'UTR GFP Stable Cell Line

TU250074 1.0 ml Ask for price

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ABCF3 Rabbit Polyclonal Antibody