AFF4 Rabbit Polyclonal Antibody

AFF4 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

AFF4 Polyclonal Antibody

ABP57723-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AFF4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of AFF4 from Human, Mouse. This AFF4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AFF4 protein at amino acid sequence of 30-110

AFF4 Polyclonal Antibody

ABP57723-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AFF4 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of AFF4 from Human, Mouse. This AFF4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AFF4 protein at amino acid sequence of 30-110

AFF4 Rabbit pAb

A4644-100ul 100 ul
EUR 308

AFF4 Rabbit pAb

A4644-200ul 200 ul
EUR 459

AFF4 Rabbit pAb

A4644-20ul 20 ul
EUR 183

AFF4 Rabbit pAb

A4644-50ul 50 ul
EUR 223

AFF4 Antibody

ABD9180 100 ug
EUR 438

AFF4 Antibody

45755-100ul 100ul
EUR 252

AFF4 Antibody

45755-50ul 50ul
EUR 187

AFF4 antibody

70R-15618 50 ul
EUR 435
Description: Rabbit polyclonal AFF4 antibody

AFF4 Antibody

DF9180 200ul
EUR 304
Description: AFF4 Antibody detects endogenous levels of total AFF4.

AFF4 Antibody

1-CSB-PA890687LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:2000-1:5000

AFF4 Antibody

1-CSB-PA001415GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

AFF4 Conjugated Antibody

C45755 100ul
EUR 397

anti- AFF4 antibody

FNab00196 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: AF4/FMR2 family, member 4
  • Uniprot ID: Q9UHB7
  • Gene ID: 27125
  • Research Area: Cancer, Metabolism
Description: Antibody raised against AFF4

anti- AFF4 antibody

FNab00197 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:1000
  • Immunogen: AF4/FMR2 family, member 4
  • Uniprot ID: Q9UHB7
  • Gene ID: 27125
  • Research Area: Cancer, Metabolism
Description: Antibody raised against AFF4

Anti-AFF4 Antibody

A03824 100ug/vial
EUR 334

Anti-AFF4 antibody

PAab00196 100 ug
EUR 355

Anti-AFF4 antibody

PAab00197 100 ug
EUR 355

Anti-AFF4 antibody

STJ22540 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23).

Anti-AFF4 antibody

STJ190525 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AFF4

AFF4 siRNA

20-abx906952
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AFF4 siRNA

20-abx906953
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-AFF4

YF-PA18383 50 ug
EUR 363
Description: Mouse polyclonal to AFF4

anti-AFF4

YF-PA18384 100 ug
EUR 403
Description: Rabbit polyclonal to AFF4

anti-AFF4

YF-PA26038 50 ul
EUR 334
Description: Mouse polyclonal to AFF4

AFF4 Antibody, HRP conjugated

1-CSB-PA890687LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AFF4 Antibody, FITC conjugated

1-CSB-PA890687LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AFF4 Antibody, Biotin conjugated

1-CSB-PA890687LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

AFF4 Blocking Peptide

DF9180-BP 1mg
EUR 195

AFF4 cloning plasmid

CSB-CL890687HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1098
  • Sequence: atgaaccgtgaagaccggaatgtgctgcgtatgaaagaacgggaaaggcggaatcaggaaattcagcagggcgaagacgccttcccacctagctctcctctctttgcagagccatacaaagttactagcaaagaagataagttatcaagtcgtattcagagtatgcttggaaact
  • Show more
Description: A cloning plasmid for the AFF4 gene.

AFF4 cloning plasmid

CSB-CL890687HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1062
  • Sequence: atgaaccgtgaagaccggaatgtgctgcgtatgaaagaacgggaaaggcggaatcaggaaattcagcagggcgaagacgccttcccacctagctctcctctctttgcagagccatacaaagttactagcaaagaagataagttatcaagtcgtattcagagtatgcttggaaact
  • Show more
Description: A cloning plasmid for the AFF4 gene.

pDONR223-AFF4 Plasmid

PVTB00802 2 ug
EUR 356

pENTR223-AFF4 vector

PVT12009 2 ug
EUR 308

Anti-AFF4 (2E12)

YF-MA11449 100 ug
EUR 363
Description: Mouse monoclonal to AFF4

Mouse AFF4 shRNA Plasmid

20-abx979227
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AFF4 ELISA KIT|Human

EF007649 96 Tests
EUR 689

Human AFF4 shRNA Plasmid

20-abx958979
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit

E04A1303-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit

E04A1303-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit

E04A1303-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AF4/FMR2 Family Member 4 (AFF4) Antibody

20-abx110898
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

20-abx148042
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

20-abx003497
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

20-abx317951
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

abx230196-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

abx230197-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

AFF4 ORF Vector (Human) (pORF)

ORF000229 1.0 ug DNA
EUR 95

AFF4 ORF Vector (Human) (pORF)

ORF000230 1.0 ug DNA
EUR 95

AFF4 Rabbit Polyclonal Antibody