AFF4 Rabbit Polyclonal Antibody
AFF4 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 AFF4 Polyclonal Antibody |
|
ABP57723-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human AFF4 protein at amino acid sequence of 30-110
- Applications tips:
|
|
Description: A polyclonal antibody for detection of AFF4 from Human, Mouse. This AFF4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AFF4 protein at amino acid sequence of 30-110 |
AFF4 Polyclonal Antibody |
|
ABP57723-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AFF4 protein at amino acid sequence of 30-110
- Applications tips:
|
|
Description: A polyclonal antibody for detection of AFF4 from Human, Mouse. This AFF4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AFF4 protein at amino acid sequence of 30-110 |
 AFF4 Rabbit pAb |
|
A4644-100ul |
Abclonal |
100 ul |
EUR 308 |
AFF4 Rabbit pAb |
|
A4644-200ul |
Abclonal |
200 ul |
EUR 459 |
AFF4 Rabbit pAb |
|
A4644-20ul |
Abclonal |
20 ul |
EUR 183 |
AFF4 Rabbit pAb |
|
A4644-50ul |
Abclonal |
50 ul |
EUR 223 |
 AFF4 Antibody |
|
45755-100ul |
SAB |
100ul |
EUR 252 |
AFF4 Antibody |
|
45755-50ul |
SAB |
50ul |
EUR 187 |
 AFF4 antibody |
|
70R-15618 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal AFF4 antibody |
AFF4 Antibody |
|
DF9180 |
Affbiotech |
200ul |
EUR 304 |
|
Description: AFF4 Antibody detects endogenous levels of total AFF4. |
AFF4 Antibody |
|
1-CSB-PA890687LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:2000-1:5000 |
AFF4 Antibody |
|
1-CSB-PA001415GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
 AFF4 Conjugated Antibody |
|
C45755 |
SAB |
100ul |
EUR 397 |
 anti- AFF4 antibody |
|
FNab00196 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- Immunogen: AF4/FMR2 family, member 4
- Uniprot ID: Q9UHB7
- Gene ID: 27125
- Research Area: Cancer, Metabolism
|
|
Description: Antibody raised against AFF4 |
anti- AFF4 antibody |
|
FNab00197 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:1000
- Immunogen: AF4/FMR2 family, member 4
- Uniprot ID: Q9UHB7
- Gene ID: 27125
- Research Area: Cancer, Metabolism
|
|
Description: Antibody raised against AFF4 |
 Anti-AFF4 Antibody |
|
A03824 |
BosterBio |
100ug/vial |
EUR 334 |
 Anti-AFF4 antibody |
|
STJ22540 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). |
Anti-AFF4 antibody |
|
STJ190525 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to AFF4 |
 AFF4 siRNA |
|
20-abx906952 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AFF4 siRNA |
|
20-abx906953 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-AFF4 |
|
YF-PA18383 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to AFF4 |
anti-AFF4 |
|
YF-PA18384 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to AFF4 |
anti-AFF4 |
|
YF-PA26038 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to AFF4 |
 AFF4 Antibody, HRP conjugated |
|
1-CSB-PA890687LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 AFF4 Antibody, FITC conjugated |
|
1-CSB-PA890687LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 AFF4 Antibody, Biotin conjugated |
|
1-CSB-PA890687LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 AFF4 Blocking Peptide |
|
DF9180-BP |
Affbiotech |
1mg |
EUR 195 |
 AFF4 cloning plasmid |
|
CSB-CL890687HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1098
- Sequence: atgaaccgtgaagaccggaatgtgctgcgtatgaaagaacgggaaaggcggaatcaggaaattcagcagggcgaagacgccttcccacctagctctcctctctttgcagagccatacaaagttactagcaaagaagataagttatcaagtcgtattcagagtatgcttggaaact
- Show more
|
|
Description: A cloning plasmid for the AFF4 gene. |
AFF4 cloning plasmid |
|
CSB-CL890687HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1062
- Sequence: atgaaccgtgaagaccggaatgtgctgcgtatgaaagaacgggaaaggcggaatcaggaaattcagcagggcgaagacgccttcccacctagctctcctctctttgcagagccatacaaagttactagcaaagaagataagttatcaagtcgtattcagagtatgcttggaaact
- Show more
|
|
Description: A cloning plasmid for the AFF4 gene. |
) Anti-AFF4 (2E12) |
|
YF-MA11449 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to AFF4 |
 Mouse AFF4 shRNA Plasmid |
|
20-abx979227 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human AFF4 shRNA Plasmid |
|
20-abx958979 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 ELISA kit) Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit |
|
E04A1303-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit |
|
E04A1303-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit |
|
E04A1303-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) AF4/FMR2 Family Member 4 (AFF4) Antibody |
|
20-abx110898 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
|
20-abx148042 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
|
20-abx003497 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
|
20-abx317951 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
|
abx230196-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
|
abx230197-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 (pORF)) AFF4 ORF Vector (Human) (pORF) |
|
ORF000229 |
ABM |
1.0 ug DNA |
EUR 95 |
AFF4 ORF Vector (Human) (pORF) |
|
ORF000230 |
ABM |
1.0 ug DNA |
EUR 95 |
AFF4 Rabbit Polyclonal Antibody
