ATP5L Rabbit Polyclonal Antibody

ATP5L Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ATP5L Polyclonal Antibody

ES9415-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATP5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ATP5L Polyclonal Antibody

ES9415-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATP5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ATP5L Rabbit pAb

A9178-100ul 100 ul
EUR 308

ATP5L Rabbit pAb

A9178-200ul 200 ul
EUR 459

ATP5L Rabbit pAb

A9178-20ul 20 ul
EUR 183

ATP5L Rabbit pAb

A9178-50ul 50 ul
EUR 223

ATP5L antibody

70R-15912 50 ul
EUR 435
Description: Rabbit polyclonal ATP5L antibody

ATP5L Antibody

45786-100ul 100ul
EUR 252

ATP5L Antibody

45786-50ul 50ul
EUR 187

ATP5L Antibody

1-CSB-PA002374GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ATP5L. Recognizes ATP5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ATP5L Antibody

1-CSB-PA002374LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP5L. Recognizes ATP5L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

ATP5L Antibody

DF9241 200ul
EUR 304
Description: ATP5L Antibody detects endogenous levels of total ATP5L.

ATP5L Antibody

ABD9241 100 ug
EUR 438

ATP5L Conjugated Antibody

C45786 100ul
EUR 397

anti- ATP5L antibody

FNab00712 100µg
EUR 548.75
  • Immunogen: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G
  • Uniprot ID: O75964
  • Gene ID: 10632
  • Research Area: Metabolism
Description: Antibody raised against ATP5L

Anti-ATP5L antibody

PAab00712 100 ug
EUR 386

Anti-ATP5L antibody

STJ113620 100 µl
EUR 277
Description: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the g subunit of the Fo complex. Alternative splicing results in multiple transcript variants.

Anti-ATP5L antibody

STJ190573 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ATP5L

ATP5L siRNA

20-abx900536
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATP5L siRNA

20-abx908587
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATP5L siRNA

20-abx908588
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATP5L Antibody, HRP conjugated

1-CSB-PA002374LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP5L. Recognizes ATP5L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ATP5L Antibody, FITC conjugated

1-CSB-PA002374LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP5L. Recognizes ATP5L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ATP5L Antibody, Biotin conjugated

1-CSB-PA002374LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP5L. Recognizes ATP5L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ATP5L Blocking Peptide

DF9241-BP 1mg
EUR 195

ATP5L cloning plasmid

CSB-CL002374HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 312
  • Sequence: atggcccaatttgtccgtaaccttgtggagaagaccccggcgctggtgaacgctgctgtgacttactcgaagcctcgattggccacattttggtactacgccaaggttgagctggttcctcccacccctgctgagatccctagagctattcagagcctgaaaaaaatagccaatag
  • Show more
Description: A cloning plasmid for the ATP5L gene.

ATP5L cloning plasmid

CSB-CL002374HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 312
  • Sequence: atggcccaatttgtccgtaaccttgtggagaagaccccggcgctggtgaacgctgctgtgacttactcgaagcctcgattggccacattttggtactacgccaaggttgagctggttcctcccacccctgctgagatccctagagctattcagagcctgaaaaaaatagtcaatag
  • Show more
Description: A cloning plasmid for the ATP5L gene.

ATP5L ELISA KIT|Human

EF007993 96 Tests
EUR 689

Rat ATP5L shRNA Plasmid

20-abx989066
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ATP5L shRNA Plasmid

20-abx973918
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ATP5L shRNA Plasmid

20-abx957243
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ATP5L Recombinant Protein (Human)

RP002341 100 ug Ask for price

ATP5L Recombinant Protein (Human)

RP002344 100 ug Ask for price

ATP5L Recombinant Protein (Mouse)

RP118019 100 ug Ask for price

ATP5L Recombinant Protein (Rat)

RP191495 100 ug Ask for price

Rabbit ATP synthase subunit g, mitochondrial(ATP5L) ELISA kit

E04A1104-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit g, mitochondrial(ATP5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP synthase subunit g, mitochondrial(ATP5L) ELISA kit

E04A1104-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit g, mitochondrial(ATP5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP synthase subunit g, mitochondrial(ATP5L) ELISA kit

E04A1104-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit g, mitochondrial(ATP5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ATP Synthase Subunit G, Mitochondrial (ATP5L) Antibody

20-abx111125
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Synthase Subunit G, Mitochondrial (ATP5L) Antibody

20-abx124523
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Synthase Subunit G, Mitochondrial (ATP5L) Antibody

abx122571-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATP Synthase Subunit G, Mitochondrial (ATP5L) Antibody

20-abx148418
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Synthase Subunit G, Mitochondrial (ATP5L) Antibody

abx230712-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Atp5l ORF Vector (Rat) (pORF)

ORF063833 1.0 ug DNA
EUR 506

ATP5L ORF Vector (Human) (pORF)

ORF000781 1.0 ug DNA
EUR 95

ATP5L ORF Vector (Human) (pORF)

ORF000782 1.0 ug DNA
EUR 95

Atp5l ORF Vector (Mouse) (pORF)

ORF039341 1.0 ug DNA
EUR 506

Atp5l sgRNA CRISPR Lentivector set (Rat)

K7272701 3 x 1.0 ug
EUR 339

Atp5l sgRNA CRISPR Lentivector set (Mouse)

K4533001 3 x 1.0 ug
EUR 339

ATP5L sgRNA CRISPR Lentivector set (Human)

K0150201 3 x 1.0 ug
EUR 339

Atp5l sgRNA CRISPR Lentivector (Rat) (Target 1)

K7272702 1.0 ug DNA
EUR 154

Atp5l sgRNA CRISPR Lentivector (Rat) (Target 2)

K7272703 1.0 ug DNA
EUR 154

Atp5l sgRNA CRISPR Lentivector (Rat) (Target 3)

K7272704 1.0 ug DNA
EUR 154

Atp5l sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4533002 1.0 ug DNA
EUR 154

Atp5l sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4533003 1.0 ug DNA
EUR 154

Atp5l sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4533004 1.0 ug DNA
EUR 154

ATP5L sgRNA CRISPR Lentivector (Human) (Target 1)

K0150202 1.0 ug DNA
EUR 154

ATP5L sgRNA CRISPR Lentivector (Human) (Target 2)

K0150203 1.0 ug DNA
EUR 154

ATP5L sgRNA CRISPR Lentivector (Human) (Target 3)

K0150204 1.0 ug DNA
EUR 154

ATP5L Protein Vector (Mouse) (pPB-C-His)

PV157362 500 ng
EUR 603

ATP5L Protein Vector (Mouse) (pPB-N-His)

PV157363 500 ng
EUR 603

ATP5L Protein Vector (Mouse) (pPM-C-HA)

PV157364 500 ng
EUR 603

ATP5L Protein Vector (Mouse) (pPM-C-His)

PV157365 500 ng
EUR 603

ATP5L Protein Vector (Rat) (pPB-C-His)

PV255330 500 ng
EUR 603

ATP5L Protein Vector (Rat) (pPB-N-His)

PV255331 500 ng
EUR 603

ATP5L Protein Vector (Rat) (pPM-C-HA)

PV255332 500 ng
EUR 603

ATP5L Protein Vector (Rat) (pPM-C-His)

PV255333 500 ng
EUR 603

ATP5L Protein Vector (Human) (pPB-His-MBP)

PV325294 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPB-His-GST)

PV325295 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPB-His-MBP)

PV325298 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPB-His-GST)

PV325299 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPB-C-His)

PV003121 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPB-N-His)

PV003122 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPM-C-HA)

PV003123 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPM-C-His)

PV003124 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPB-C-His)

PV003125 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPB-N-His)

PV003126 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPM-C-HA)

PV003127 500 ng
EUR 329

ATP5L Protein Vector (Human) (pPM-C-His)

PV003128 500 ng
EUR 329

Atp5l 3'UTR GFP Stable Cell Line

TU152334 1.0 ml Ask for price

Atp5l 3'UTR Luciferase Stable Cell Line

TU102334 1.0 ml Ask for price

Atp5l 3'UTR Luciferase Stable Cell Line

TU201090 1.0 ml Ask for price

Atp5l 3'UTR GFP Stable Cell Line

TU251090 1.0 ml Ask for price

ATP5L 3'UTR GFP Stable Cell Line

TU051429 1.0 ml
EUR 1394

ATP5L 3'UTR Luciferase Stable Cell Line

TU001429 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

ATP5L Rabbit Polyclonal Antibody