AXIN1 Rabbit Polyclonal Antibody

AXIN1 Rabbit Polyclonal Antibody

Order Now:

AXIN1 Polyclonal Antibody

ES9440-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AXIN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AXIN1 Polyclonal Antibody

ES9440-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AXIN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AXIN1 Rabbit pAb

A16019-100ul 100 ul
EUR 308

AXIN1 Rabbit pAb

A16019-200ul 200 ul
EUR 459

AXIN1 Rabbit pAb

A16019-20ul 20 ul
EUR 183

AXIN1 Rabbit pAb

A16019-50ul 50 ul
EUR 223

AXIN1 Rabbit pAb

A0583-100ul 100 ul
EUR 308

AXIN1 Rabbit pAb

A0583-200ul 200 ul
EUR 459

AXIN1 Rabbit pAb

A0583-20ul 20 ul Ask for price

AXIN1 Rabbit pAb

A0583-50ul 50 ul Ask for price

AXIN1 Antibody

25201-100ul 100ul
EUR 390

AXIN1 Antibody

43229-100ul 100ul
EUR 252

AXIN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AXIN1. Recognizes AXIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

AXIN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AXIN1. Recognizes AXIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

AXIN1 Antibody

DF9264 200ul
EUR 304
Description: AXIN1 Antibody detects endogenous levels of total AXIN1.

AXIN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXIN1. Recognizes AXIN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

AXIN1 antibody

70R-51344 100 ul
EUR 244
Description: Purified Polyclonal AXIN1 antibody

AXIN1 Antibody

ABD9264 100 ug
EUR 438

Polyclonal AXIN1 Antibody (C-term)

APR03646G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AXIN1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-AXIN1 Antibody

APG00043G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AXIN1 . This antibody is tested and proven to work in the following applications:

AXIN1 Conjugated Antibody

C43229 100ul
EUR 397

anti- AXIN1 antibody

FNab00752 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: axin 1
  • Uniprot ID: O15169
  • Gene ID: 8312
  • Research Area: Cancer, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against AXIN1

Anti-AXIN1 antibody

PAab00752 100 ug
EUR 355

Anti-AXIN1 antibody

STJ110996 100 µl
EUR 277
Description: This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants.

Anti-AXIN1 antibody

STJ118473 100 µl
EUR 277

Anti-AXIN1 antibody

STJ190598 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AXIN1

Anti-AXIN1 antibody

STJ70148 100 µg
EUR 359

Axin1/ Rat Axin1 ELISA Kit

ELI-11470r 96 Tests
EUR 886

Polyclonal AXIN1 / Axin-1 Antibody (C-Terminus)

APR02856G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AXIN1 / Axin-1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal AXIN1 / Axin-1 Antibody (C-Terminus)

APR03361G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AXIN1 / Axin-1 (C-Terminus). This antibody is tested and proven to work in the following applications:

AXIN1 up-regulated 1 (AXUD1) polyclonal antibody

ABP-PAB-10275 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT14228 2 ug
EUR 599


PVT14479 2 ug
EUR 599

AXIN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXIN1. Recognizes AXIN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AXIN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXIN1. Recognizes AXIN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AXIN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXIN1. Recognizes AXIN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

AXIN1 Blocking Peptide

DF9264-BP 1mg
EUR 195

AXIN1 cloning plasmid

CSB-CL517675HU-10ug 10ug
EUR 804
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2481
  • Sequence: atgaatatccaagagcagggtttccccttggacctcggagcaagtttcaccgaagatgctccccgacccccagtgcctggtgaggagggagaactggtgtccacagacccgaggcccgccagctacagtttctgctccgggaaaggtgttggcattaaaggtgagacttcgacgg
  • Show more
Description: A cloning plasmid for the AXIN1 gene.

Axis Inhibition Protein 1 (AXIN1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody

abx448563-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody

abx431120-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody

abx230752-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.


ELA-E9657h 96 Tests
EUR 824


EF006531 96 Tests
EUR 689

Rat AXIN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AXIN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AXIN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal AXIN1 Antibody (monoclonal) (M01), Clone: 2B11

APR14311G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human AXIN1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B11. This antibody is applicable in WB and IF, E

Axis Inhibition Protein 1 (AXIN1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ALP)

abx446475-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (APC)

abx446476-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (PerCP)

abx446481-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (RPE)

abx446482-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (Streptavidin)

abx446483-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axin1 ORF Vector (Rat) (pORF)

ORF063893 1.0 ug DNA
EUR 506

AXIN1 ORF Vector (Human) (pORF)

ORF000829 1.0 ug DNA
EUR 95

Axin1 ORF Vector (Mouse) (pORF)

ORF039460 1.0 ug DNA
EUR 506

Axin1 ORF Vector (Mouse) (pORF)

ORF039461 1.0 ug DNA
EUR 506

AXIN1 ELISA Kit (Rat) (OKEH05939)

OKEH05939 96 Wells
EUR 727
Description: Description of target: Component of the beta-catenin destruction complex required for regulating CTNNB1 levels through phosphorylation and ubiquitination, and modulating Wnt-signaling. Controls dorsoventral patterning via two opposing effects; down-regulates beta-catenin to inhibit the Wnt signaling pathway and ventralize embryos, but also dorsalizes embryos by activating a Wnt-independent JNK signaling pathway. Also facilitates the phosphorylation of APC by GSK3B. Facilitates the phosphorylation of TP53 by HIPK2 upon ultraviolet irradiation. Enhances TGF-beta signaling by recruiting the RNF111 E3 ubiquitin ligase and promoting the degradation of inhibitory SMAD7.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

AXIN1 ELISA Kit (Chicken) (OKEH06692)

OKEH06692 96 Wells
EUR 844
Description: Description of target: Controls dorsoventral patterning via two opposing effects; down-regulates beta-catenin to inhibit the Wnt signaling pathway and ventralize embryos, but also dorsalizes embryos by activating a Wnt-independent JNK signaling pathway. ;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.094 ng/mL

AXIN1 ELISA Kit (Mouse) (OKEH06819)

OKEH06819 96 Wells
EUR 727
Description: Description of target: Component of the beta-catenin destruction complex required for regulating CTNNB1 levels through phosphorylation and ubiquitination, and modulating Wnt-signaling;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 78 pg/mL

AXIN1 ELISA Kit (Rat) (OKEH06820)

OKEH06820 96 Wells
EUR 727
Description: Description of target: Component of the beta-catenin destruction complex required for regulating CTNNB1 levels through phosphorylation and ubiquitination, and modulating Wnt-signaling. Controls dorsoventral patterning via two opposing effects; down-regulates beta-catenin to inhibit the Wnt signaling pathway and ventralize embryos, but also dorsalizes embryos by activating a Wnt-independent JNK signaling pathway. Also facilitates the phosphorylation of APC by GSK3B. Facilitates the phosphorylation of TP53 by HIPK2 upon ultraviolet irradiation. Enhances TGF-beta signaling by recruiting the RNF111 E3 ubiquitin ligase and promoting the degradation of inhibitory SMAD7;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

AXIN1 ELISA Kit (Mouse) (OKEH04969)

OKEH04969 96 Wells
EUR 727
Description: Description of target: Component of the beta-catenin destruction complex required for regulating CTNNB1 levels through phosphorylation and ubiquitination, and modulating Wnt-signaling. Controls dorsoventral patterning via two opposing effects; down-regulates CTNNB1 to inhibit the Wnt signaling pathway and ventralize embryos, but also dorsalizes embryos by activating a Wnt-independent JNK signaling pathway. In Wnt signaling, probably facilitates the phosphorylation of CTNNB1 and APC by GSK3B. Likely to function as a tumor suppressor. Facilitates the phosphorylation of TP53 by HIPK2 upon ultraviolet irradiation. Enhances TGF-beta signaling by recruiting the RNF111 E3 ubiquitin ligase and promoting the degradation of inhibitory SMAD7. Also component of the AXIN1-HIPK2-TP53 complex which controls cell growth, apoptosis and development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.8 pg/mL

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 390)

abx446467-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 488)

abx446468-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 565)

abx446469-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 594)

abx446470-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 633)

abx446471-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 655)

abx446472-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 680)

abx446473-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Axis Inhibition Protein 1 (AXIN1) Antibody (ATTO 700)

abx446474-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Chicken AXIN1/ Axin-1 ELISA Kit

E0004Ch 1 Kit
EUR 717

Rat Axin1/ Axin-1 ELISA Kit

E0111Ra 1 Kit
EUR 646

Mouse Axin1/ Axin-1 ELISA Kit

E0152Mo 1 Kit
EUR 632

Human AXIN1/ Axin-1 ELISA Kit

E0240Hu 1 Kit
EUR 605

Human AXIN1(Axin-1) ELISA Kit

EH2497 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O15169
  • Alias: AXIN1/axin 1/axin-1/AXINaxis inhibitor 1/Axis inhibition protein 1/fused, mouse, homolog of/hAxin/MGC52315
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Chicken Axin- 1, AXIN1 ELISA KIT

ELI-11469c 96 Tests
EUR 928

Human Axin- 1, AXIN1 ELISA KIT

ELI-12024h 96 Tests
EUR 824

Mouse Axin- 1, Axin1 ELISA KIT

ELI-49614m 96 Tests
EUR 865

Axin1 sgRNA CRISPR Lentivector set (Rat)

K6723901 3 x 1.0 ug
EUR 339

AXIN1 sgRNA CRISPR Lentivector set (Human)

K0161201 3 x 1.0 ug
EUR 339

Axin1 sgRNA CRISPR Lentivector set (Mouse)

K3964701 3 x 1.0 ug
EUR 339

Axis Inhibition Protein 1 (AXIN1) Antibody (PE/ATTO 594)

abx446480-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Axin1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6723902 1.0 ug DNA
EUR 154

Axin1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6723903 1.0 ug DNA
EUR 154

Axin1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6723904 1.0 ug DNA
EUR 154

AXIN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0161202 1.0 ug DNA
EUR 154

AXIN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0161203 1.0 ug DNA
EUR 154

AXIN1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0161204 1.0 ug DNA
EUR 154

Axin1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3964702 1.0 ug DNA
EUR 154

Axin1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3964703 1.0 ug DNA
EUR 154

Axin1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3964704 1.0 ug DNA
EUR 154

Axin1 Protein Vector (Mouse) (pPB-C-His)

PV157838 500 ng
EUR 1065

Axin1 Protein Vector (Mouse) (pPB-N-His)

PV157839 500 ng
EUR 1065

Axin1 Protein Vector (Mouse) (pPM-C-HA)

PV157840 500 ng
EUR 1065

Axin1 Protein Vector (Mouse) (pPM-C-His)

PV157841 500 ng
EUR 1065

Axin1 Protein Vector (Mouse) (pPB-C-His)

PV157842 500 ng
EUR 1065

Axin1 Protein Vector (Mouse) (pPB-N-His)

PV157843 500 ng
EUR 1065

Axin1 Protein Vector (Mouse) (pPM-C-HA)

PV157844 500 ng
EUR 1065

Axin1 Protein Vector (Mouse) (pPM-C-His)

PV157845 500 ng
EUR 1065

Axin1 Protein Vector (Rat) (pPB-C-His)

PV255570 500 ng
EUR 1166

Axin1 Protein Vector (Rat) (pPB-N-His)

PV255571 500 ng
EUR 1166

Axin1 Protein Vector (Rat) (pPM-C-HA)

PV255572 500 ng
EUR 1166

Axin1 Protein Vector (Rat) (pPM-C-His)

PV255573 500 ng
EUR 1166

AXIN1 Protein Vector (Human) (pPB-His-MBP)

PV325834 500 ng
EUR 329

AXIN1 Protein Vector (Human) (pPB-His-GST)

PV325835 500 ng
EUR 329

Axin1 Protein Vector (Human) (pPB-C-His)

PV003313 500 ng
EUR 329

Axin1 Protein Vector (Human) (pPB-N-His)

PV003314 500 ng
EUR 329

Axin1 Protein Vector (Human) (pPM-C-HA)

PV003315 500 ng
EUR 329

Axin1 Protein Vector (Human) (pPM-C-His)

PV003316 500 ng
EUR 329

Axin1 3'UTR GFP Stable Cell Line

TU152432 1.0 ml Ask for price

Axin1 3'UTR Luciferase Stable Cell Line

TU102432 1.0 ml Ask for price

AXIN1 Rabbit Polyclonal Antibody