CABYR Rabbit Polyclonal Antibody

CABYR Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

CABYR Polyclonal Antibody

ABP57952-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CABYR protein
  • Applications tips:
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein

CABYR Polyclonal Antibody

ABP57952-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CABYR protein
  • Applications tips:
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein

CABYR Polyclonal Antibody

ES9475-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CABYR from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CABYR Polyclonal Antibody

ES9475-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CABYR from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CABYR antibody

70R-16116 50 ul
EUR 435
Description: Rabbit polyclonal CABYR antibody

CABYR Antibody

45830-100ul 100ul
EUR 252

CABYR Antibody

45830-50ul 50ul
EUR 187

CABYR Antibody

1-CSB-PA004393GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CABYR. Recognizes CABYR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CABYR Antibody

DF9310 200ul
EUR 304
Description: CABYR Antibody detects endogenous levels of total CABYR.

CABYR Antibody

ABD13032 100 ug
EUR 438

CABYR Antibody

ABD9310 100 ug
EUR 438

CABYR Conjugated Antibody

C45830 100ul
EUR 397

anti- CABYR antibody

FNab01170 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: calcium binding tyrosine-(Y)-phosphorylation regulated
  • Uniprot ID: O75952
  • Gene ID: 26256
  • Research Area: Signal Transduction
Description: Antibody raised against CABYR

Anti-CABYR antibody

PAab01170 100 ug
EUR 386

Anti-CABYR antibody

STJ190633 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CABYR

CABYR siRNA

20-abx910054
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CABYR siRNA

20-abx910055
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CABYR

YF-PA18264 50 ug
EUR 363
Description: Mouse polyclonal to CABYR

CABYR Blocking Peptide

DF9310-BP 1mg
EUR 195

CABYR cloning plasmid

CSB-CL004393HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Sequence: atgatttcttcaaagcccagacttgtcgtaccctatggcctcaagactctgctcgagggaattagcagagctgttctcaaaaccaacccatcaaacatcaaccagtttgcagcagcttattttcaagaacttactatgtatagagggaatactactatggatataaaagatctgg
  • Show more
Description: A cloning plasmid for the CABYR gene.

Recombinant Human CABYR

P0559 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: O75952
Description: Recombinant Human protein for CABYR

pCMV-SPORT6-CABYR

PVT13645 2 ug
EUR 391

Human CABYR ELISA KIT

ELI-10860h 96 Tests
EUR 824

Mouse Cabyr ELISA KIT

ELI-11117m 96 Tests
EUR 865

CABYR ELISA KIT|Human

EF008319 96 Tests
EUR 689

Mouse CABYR shRNA Plasmid

20-abx977359
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CABYR shRNA Plasmid

20-abx958781
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CABYR Recombinant Protein (Human)

RP005416 100 ug Ask for price

CABYR Recombinant Protein (Rat)

RP192764 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120530 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120533 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120536 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120539 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120542 100 ug Ask for price

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody

abx036854-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody

abx029847-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody

abx029847-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody

20-abx318381
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cabyr ORF Vector (Rat) (pORF)

ORF064256 1.0 ug DNA
EUR 506

CABYR ORF Vector (Human) (pORF)

ORF001806 1.0 ug DNA
EUR 95

Cabyr ORF Vector (Mouse) (pORF)

ORF040178 1.0 ug DNA
EUR 506

Cabyr ORF Vector (Mouse) (pORF)

ORF040179 1.0 ug DNA
EUR 506

Cabyr ORF Vector (Mouse) (pORF)

ORF040180 1.0 ug DNA
EUR 506

Cabyr ORF Vector (Mouse) (pORF)

ORF040181 1.0 ug DNA
EUR 506

Cabyr ORF Vector (Mouse) (pORF)

ORF040182 1.0 ug DNA
EUR 506

Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit

E04C1302-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit

E04C1302-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit

E04C1302-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody

20-abx111304
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody

20-abx148788
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody

abx340188-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (HRP)

20-abx307471
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (FITC)

20-abx307472
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (Biotin)

20-abx307473
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody

abx231170-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

CABYR sgRNA CRISPR Lentivector set (Human)

K0350201 3 x 1.0 ug
EUR 339

Cabyr sgRNA CRISPR Lentivector set (Rat)

K6521601 3 x 1.0 ug
EUR 339

Cabyr sgRNA CRISPR Lentivector set (Mouse)

K4072601 3 x 1.0 ug
EUR 339

CABYR sgRNA CRISPR Lentivector (Human) (Target 1)

K0350202 1.0 ug DNA
EUR 154

CABYR sgRNA CRISPR Lentivector (Human) (Target 2)

K0350203 1.0 ug DNA
EUR 154

CABYR sgRNA CRISPR Lentivector (Human) (Target 3)

K0350204 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Rat) (Target 1)

K6521602 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Rat) (Target 2)

K6521603 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Rat) (Target 3)

K6521604 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4072602 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4072603 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4072604 1.0 ug DNA
EUR 154

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160710 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160711 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160712 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160713 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160714 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160715 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160716 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160717 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160718 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160719 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160720 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160721 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160722 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160723 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160724 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160725 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160726 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160727 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160728 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160729 500 ng
EUR 603

CABYR Protein Vector (Rat) (pPB-C-His)

PV257022 500 ng
EUR 603

CABYR Protein Vector (Rat) (pPB-N-His)

PV257023 500 ng
EUR 603

CABYR Protein Vector (Rat) (pPM-C-HA)

PV257024 500 ng
EUR 603

CABYR Protein Vector (Rat) (pPM-C-His)

PV257025 500 ng
EUR 603

CABYR Protein Vector (Human) (pPB-C-His)

PV007221 500 ng
EUR 329

CABYR Protein Vector (Human) (pPB-N-His)

PV007222 500 ng
EUR 329

CABYR Protein Vector (Human) (pPM-C-HA)

PV007223 500 ng
EUR 329

CABYR Protein Vector (Human) (pPM-C-His)

PV007224 500 ng
EUR 329

Cabyr 3'UTR GFP Stable Cell Line

TU153009 1.0 ml Ask for price

Cabyr 3'UTR Luciferase Stable Cell Line

TU103009 1.0 ml Ask for price

Cabyr 3'UTR Luciferase Stable Cell Line

TU201540 1.0 ml Ask for price

Cabyr 3'UTR GFP Stable Cell Line

TU251540 1.0 ml Ask for price

CABYR 3'UTR GFP Stable Cell Line

TU053350 1.0 ml
EUR 1394

CABYR 3'UTR Luciferase Stable Cell Line

TU003350 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

CABYR Rabbit Polyclonal Antibody