CBLB Rabbit Polyclonal Antibody

CBLB Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

CBLB Polyclonal Antibody
ES9621-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CBLB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CBLB Polyclonal Antibody
ES9621-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CBLB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CBLB Rabbit pAb
A2014-100ul	Abclonal	100 ul	EUR 308

CBLB Rabbit pAb
A2014-200ul	Abclonal	200 ul	EUR 459

CBLB Rabbit pAb
A2014-20ul	Abclonal	20 ul	EUR 183

CBLB Rabbit pAb
A2014-50ul	Abclonal	50 ul	EUR 223

Polyclonal CBLB Antibody (Center)
APR06112G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CBLB (Center). This antibody is tested and proven to work in the following applications:

CBLB antibody
70R-16192	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CBLB antibody

CBLB Antibody
32551-100ul	SAB	100ul	EUR 252

CBLB antibody
10R-1493	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal CBLB antibody

CBLB Antibody
1-CSB-PA004579GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CBLB. Recognizes CBLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CBLB Antibody
DF6753	Affbiotech	200ul	EUR 304
Description: CBLB Antibody detects endogenous levels of total CBLB.

CBLB Antibody
ABD6753	Lifescience Market	100 ug	EUR 438

Cblb/ Rat Cblb ELISA Kit
ELI-10753r	Lifescience Market	96 Tests	EUR 886

CBLB Conjugated Antibody
C32551	SAB	100ul	EUR 397

anti- CBLB antibody
FNab01318	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: Cas-Br-M (murine) ecotropic retroviral transforming sequence b Uniprot ID: Q13191 Gene ID: 868 Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against CBLB

Anti-CBLB antibody
PAab01318	Lifescience Market	100 ug	EUR 355

Anti-CBLB antibody
STJ22915	St John's Laboratory	100 µl	EUR 277

Anti-CBLB antibody
STJ190779	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CBLB

CBLB siRNA
20-abx900811	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CBLB siRNA
20-abx910395	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CBLB siRNA
20-abx910396	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CBLB Blocking Peptide
DF6753-BP	Affbiotech	1mg	EUR 195

CBLB cloning plasmid
CSB-CL623789HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2949 Sequence: atggcaaactcaatgaatggcagaaaccctggtggtcgaggaggaaatccccgaaaaggtcgaattttgggtattattgatgctattcaggatgcagttggaccccctaagcaagctgccgcagatcgcaggaccgtggagaagacttggaagctcatggacaaagtggtaagac Show more
Description: A cloning plasmid for the CBLB gene.

pcDNA3.1-CBLB Plasmid
PVTB00815-2a	Lifescience Market	2 ug	EUR 356

Human CBLB ELISA Kit
ELA-E2531h	Lifescience Market	96 Tests	EUR 824

CBLB ELISA KIT|Human
EF006295	Lifescience Market	96 Tests	EUR 689

Rat CBLB shRNA Plasmid
20-abx987706	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CBLB shRNA Plasmid
20-abx980562	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CBLB shRNA Plasmid
20-abx950613	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Cblb ORF Vector (Rat) (pORF)
ORF064428	ABM	1.0 ug DNA	EUR 506

CBLB ORF Vector (Human) (pORF)
ORF001905	ABM	1.0 ug DNA	EUR 95

Cblb ORF Vector (Mouse) (pORF)
ORF040465	ABM	1.0 ug DNA	EUR 506

E3 Ubiquitin-Protein Ligase CBL-B (CBLB) Antibody
abx231318-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

CBLB sgRNA CRISPR Lentivector set (Human)
K0368701	ABM	3 x 1.0 ug	EUR 339

Cblb sgRNA CRISPR Lentivector set (Rat)
K7063701	ABM	3 x 1.0 ug	EUR 339

Cblb sgRNA CRISPR Lentivector set (Mouse)
K3647701	ABM	3 x 1.0 ug	EUR 339

CBLB sgRNA CRISPR Lentivector (Human) (Target 1)
K0368702	ABM	1.0 ug DNA	EUR 154

CBLB sgRNA CRISPR Lentivector (Human) (Target 2)
K0368703	ABM	1.0 ug DNA	EUR 154

CBLB sgRNA CRISPR Lentivector (Human) (Target 3)
K0368704	ABM	1.0 ug DNA	EUR 154

Cblb sgRNA CRISPR Lentivector (Rat) (Target 1)
K7063702	ABM	1.0 ug DNA	EUR 154

Cblb sgRNA CRISPR Lentivector (Rat) (Target 2)
K7063703	ABM	1.0 ug DNA	EUR 154

Cblb sgRNA CRISPR Lentivector (Rat) (Target 3)
K7063704	ABM	1.0 ug DNA	EUR 154

Cblb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3647702	ABM	1.0 ug DNA	EUR 154

Cblb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3647703	ABM	1.0 ug DNA	EUR 154

Cblb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3647704	ABM	1.0 ug DNA	EUR 154

CBLB Protein Vector (Mouse) (pPB-C-His)
PV161858	ABM	500 ng	EUR 1065

CBLB Protein Vector (Mouse) (pPB-N-His)
PV161859	ABM	500 ng	EUR 1065

CBLB Protein Vector (Mouse) (pPM-C-HA)
PV161860	ABM	500 ng	EUR 1065

CBLB Protein Vector (Mouse) (pPM-C-His)
PV161861	ABM	500 ng	EUR 1065

CBLB Protein Vector (Rat) (pPB-C-His)
PV257710	ABM	500 ng	EUR 1166

CBLB Protein Vector (Rat) (pPB-N-His)
PV257711	ABM	500 ng	EUR 1166

CBLB Protein Vector (Rat) (pPM-C-HA)
PV257712	ABM	500 ng	EUR 1166

CBLB Protein Vector (Rat) (pPM-C-His)
PV257713	ABM	500 ng	EUR 1166

CBLB Protein Vector (Human) (pPB-C-His)
PV007617	ABM	500 ng	EUR 329

CBLB Protein Vector (Human) (pPB-N-His)
PV007618	ABM	500 ng	EUR 329

CBLB Protein Vector (Human) (pPM-C-HA)
PV007619	ABM	500 ng	EUR 329

CBLB Protein Vector (Human) (pPM-C-His)
PV007620	ABM	500 ng	EUR 329

Cblb 3'UTR GFP Stable Cell Line
TU153187	ABM	1.0 ml	Ask for price

Cblb 3'UTR Luciferase Stable Cell Line
TU103187	ABM	1.0 ml	Ask for price

Cblb 3'UTR Luciferase Stable Cell Line
TU201707	ABM	1.0 ml	Ask for price

Cblb 3'UTR GFP Stable Cell Line
TU251707	ABM	1.0 ml	Ask for price

CBLB 3'UTR GFP Stable Cell Line
TU053538	ABM	1.0 ml	EUR 2333

CBLB 3'UTR Luciferase Stable Cell Line
TU003538	ABM	1.0 ml	EUR 2333

CBLB ELISA Kit (Human) : 96 Wells (OKEH01653)
OKEH01653	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 25 pg/mL

Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody
20-abx111410	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody
abx034055-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody
abx034055-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody
20-abx225075	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

CBLB Rabbit Polyclonal Antibody