CBLB Rabbit Polyclonal Antibody

CBLB Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

CBLB Polyclonal Antibody

ABP57993-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CBLB protein
  • Applications tips:
Description: A polyclonal antibody for detection of CBLB from Human. This CBLB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CBLB protein

CBLB Polyclonal Antibody

ABP57993-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CBLB protein
  • Applications tips:
Description: A polyclonal antibody for detection of CBLB from Human. This CBLB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CBLB protein

CBLB Rabbit pAb

A2014-100ul 100 ul
EUR 308

CBLB Rabbit pAb

A2014-200ul 200 ul
EUR 459

CBLB Rabbit pAb

A2014-20ul 20 ul
EUR 183

CBLB Rabbit pAb

A2014-50ul 50 ul
EUR 223

Polyclonal CBLB Antibody (Center)

APR06112G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CBLB (Center). This antibody is tested and proven to work in the following applications:

CBLB Antibody

ABD6753 100 ug
EUR 438

CBLB Antibody

32551-100ul 100ul
EUR 252

CBLB antibody

10R-1493 100 ug
EUR 512
Description: Mouse monoclonal CBLB antibody

CBLB antibody

70R-16192 50 ul
EUR 435
Description: Rabbit polyclonal CBLB antibody

CBLB Antibody

DF6753 200ul
EUR 304
Description: CBLB Antibody detects endogenous levels of total CBLB.

CBLB Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CBLB. Recognizes CBLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Cblb/ Rat Cblb ELISA Kit

ELI-10753r 96 Tests
EUR 886

CBLB Conjugated Antibody

C32551 100ul
EUR 397

anti- CBLB antibody

FNab01318 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: Cas-Br-M (murine) ecotropic retroviral transforming sequence b
  • Uniprot ID: Q13191
  • Gene ID: 868
  • Research Area: Epigenetics, Signal Transduction, Metabolism
Description: Antibody raised against CBLB

Anti-CBLB antibody

PAab01318 100 ug
EUR 355

Anti-CBLB antibody

STJ22915 100 µl
EUR 277

Anti-CBLB antibody

STJ190779 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CBLB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CBLB Blocking Peptide

DF6753-BP 1mg
EUR 195

CBLB cloning plasmid

CSB-CL623789HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2949
  • Sequence: atggcaaactcaatgaatggcagaaaccctggtggtcgaggaggaaatccccgaaaaggtcgaattttgggtattattgatgctattcaggatgcagttggaccccctaagcaagctgccgcagatcgcaggaccgtggagaagacttggaagctcatggacaaagtggtaagac
  • Show more
Description: A cloning plasmid for the CBLB gene.

pcDNA3.1-CBLB Plasmid

PVTB00815-2a 2 ug
EUR 356

Mouse CBLB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CBLB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E2531h 96 Tests
EUR 824


EF006295 96 Tests
EUR 689

Human CBLB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CBLB ORF Vector (Human) (pORF)

ORF001905 1.0 ug DNA
EUR 95

Cblb ORF Vector (Mouse) (pORF)

ORF040465 1.0 ug DNA
EUR 506

Cblb ORF Vector (Rat) (pORF)

ORF064428 1.0 ug DNA
EUR 506

E3 Ubiquitin-Protein Ligase CBL-B (CBLB) Antibody

abx231318-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CBLB sgRNA CRISPR Lentivector set (Human)

K0368701 3 x 1.0 ug
EUR 339

Cblb sgRNA CRISPR Lentivector set (Mouse)

K3647701 3 x 1.0 ug
EUR 339

Cblb sgRNA CRISPR Lentivector set (Rat)

K7063701 3 x 1.0 ug
EUR 339

CBLB sgRNA CRISPR Lentivector (Human) (Target 1)

K0368702 1.0 ug DNA
EUR 154

CBLB sgRNA CRISPR Lentivector (Human) (Target 2)

K0368703 1.0 ug DNA
EUR 154

CBLB sgRNA CRISPR Lentivector (Human) (Target 3)

K0368704 1.0 ug DNA
EUR 154

Cblb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3647702 1.0 ug DNA
EUR 154

Cblb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3647703 1.0 ug DNA
EUR 154

Cblb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3647704 1.0 ug DNA
EUR 154

Cblb sgRNA CRISPR Lentivector (Rat) (Target 1)

K7063702 1.0 ug DNA
EUR 154

Cblb sgRNA CRISPR Lentivector (Rat) (Target 2)

K7063703 1.0 ug DNA
EUR 154

Cblb sgRNA CRISPR Lentivector (Rat) (Target 3)

K7063704 1.0 ug DNA
EUR 154

CBLB Protein Vector (Human) (pPB-C-His)

PV007617 500 ng
EUR 329

CBLB Protein Vector (Human) (pPB-N-His)

PV007618 500 ng
EUR 329

CBLB Protein Vector (Human) (pPM-C-HA)

PV007619 500 ng
EUR 329

CBLB Protein Vector (Human) (pPM-C-His)

PV007620 500 ng
EUR 329

CBLB Protein Vector (Rat) (pPB-C-His)

PV257710 500 ng
EUR 1166

CBLB Protein Vector (Rat) (pPB-N-His)

PV257711 500 ng
EUR 1166

CBLB Protein Vector (Rat) (pPM-C-HA)

PV257712 500 ng
EUR 1166

CBLB Protein Vector (Rat) (pPM-C-His)

PV257713 500 ng
EUR 1166

CBLB Protein Vector (Mouse) (pPB-C-His)

PV161858 500 ng
EUR 1065

CBLB Protein Vector (Mouse) (pPB-N-His)

PV161859 500 ng
EUR 1065

CBLB Protein Vector (Mouse) (pPM-C-HA)

PV161860 500 ng
EUR 1065

CBLB Protein Vector (Mouse) (pPM-C-His)

PV161861 500 ng
EUR 1065

Cblb 3'UTR Luciferase Stable Cell Line

TU201707 1.0 ml Ask for price

Cblb 3'UTR GFP Stable Cell Line

TU153187 1.0 ml Ask for price

CBLB 3'UTR Luciferase Stable Cell Line

TU003538 1.0 ml
EUR 2333

Cblb 3'UTR Luciferase Stable Cell Line

TU103187 1.0 ml Ask for price

CBLB 3'UTR GFP Stable Cell Line

TU053538 1.0 ml
EUR 2333

Cblb 3'UTR GFP Stable Cell Line

TU251707 1.0 ml Ask for price

CBLB ELISA Kit (Human) : 96 Wells (OKEH01653)

OKEH01653 96 Wells
EUR 740
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 25 pg/mL

Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody

abx034055-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody

abx034055-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CBLB Rabbit Polyclonal Antibody