CNTFR Rabbit Polyclonal Antibody

CNTFR Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

CNTFR Polyclonal Antibody

ABP58211-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CNTFR protein
  • Applications tips:
Description: A polyclonal antibody for detection of CNTFR from Human, Mouse, Rat. This CNTFR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNTFR protein

CNTFR Polyclonal Antibody

ABP58211-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CNTFR protein
  • Applications tips:
Description: A polyclonal antibody for detection of CNTFR from Human, Mouse, Rat. This CNTFR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNTFR protein

CNTFR Polyclonal Antibody

ABP58211-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CNTFR protein
  • Applications tips:
Description: A polyclonal antibody for detection of CNTFR from Human, Mouse, Rat. This CNTFR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNTFR protein

CNTFR Polyclonal Antibody

A50133 100 µg
EUR 570.55
Description: The best epigenetics products

CNTFR Rabbit pAb

A12424-100ul 100 ul
EUR 308

CNTFR Rabbit pAb

A12424-200ul 200 ul
EUR 459

CNTFR Rabbit pAb

A12424-20ul 20 ul
EUR 183

CNTFR Rabbit pAb

A12424-50ul 50 ul
EUR 223

CNTFR Rabbit pAb

A2700-100ul 100 ul
EUR 308

CNTFR Rabbit pAb

A2700-200ul 200 ul
EUR 459

CNTFR Rabbit pAb

A2700-20ul 20 ul
EUR 183

CNTFR Rabbit pAb

A2700-50ul 50 ul
EUR 223

CNTFR Antibody

abx332250-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

CNTFR antibody

70R-9962 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CNTFR antibody

CNTFR Antibody

ABD7058 100 ug
EUR 438

CNTFR antibody

38442-100ul 100ul
EUR 252

CNTFR Antibody

31061-100ul 100ul
EUR 252

CNTFR Antibody

31061-50ul 50ul
EUR 187

CNTFR antibody

70R-16487 50 ul
EUR 435
Description: Rabbit polyclonal CNTFR antibody

CNTFR Antibody

DF7058 200ul
EUR 304
Description: CNTFR Antibody detects endogenous levels of total CNTFR.

CNTFR Antibody

1-CSB-PA005684EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200, IF:1:50-1:200

CNTFR Antibody

1-CSB-PA005684GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CNTFR Antibody

CSB-PA276708-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

CNTFR Antibody

CSB-PA276708-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

CNTFR Antibody

CSB-PA204475-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 0.5mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

CNTFR Antibody

CSB-PA204475-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 0.5mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

Rabbit CNTFR ELISA Kit

ERTC0039 96Tests
EUR 521

Polyclonal Goat Anti-CNTFR Antibody

APG03349G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CNTFR . This antibody is tested and proven to work in the following applications:

CNTFR Polyclonal Antibody, HRP Conjugated

A50134 100 µg
EUR 570.55
Description: kits suitable for this type of research

CNTFR Polyclonal Antibody, FITC Conjugated

A50135 100 µg
EUR 570.55
Description: fast delivery possible

CNTFR Polyclonal Antibody, Biotin Conjugated

A50136 100 µg
EUR 570.55
Description: reagents widely cited

Polyclonal CNTFR antibody - C-terminal region

APG03229G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNTFR - C-terminal region. This antibody is tested and proven to work in the following applications:

CNTFR Conjugated Antibody

C38442 100ul
EUR 397

CNTFR Conjugated Antibody

C31061 100ul
EUR 397

anti- CNTFR antibody

FNab01820 100µg
EUR 505.25
  • Immunogen: ciliary neurotrophic factor receptor
  • Uniprot ID: P26992
  • Gene ID: 1271
  • Research Area: Signal Transduction, Cancer, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against CNTFR

CNTFR alpha Antibody

20-abx225120
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CNTFR alpha antibody

20R-2754 50 ug
EUR 281
Description: Rabbit polyclonal CNTFR alpha antibody

Anti-CNTFR antibody

PAab01820 100 ug
EUR 355

Anti-CNTFR antibody

STJ71057 100 µg
EUR 359

Anti-CNTFR antibody

STJ23187 100 µl
EUR 277
Description: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene.

Anti-CNTFR antibody

STJ114298 100 µl
EUR 277
Description: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene.

Anti-CNTFR antibody

STJ190701 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CNTFR

Cntfr/ Rat Cntfr ELISA Kit

ELI-33030r 96 Tests
EUR 886

CNTFR siRNA

20-abx901161
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNTFR siRNA

20-abx912312
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNTFR siRNA

20-abx912313
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNTFR Antibody, HRP conjugated

1-CSB-PA005684EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CNTFR Antibody, FITC conjugated

1-CSB-PA005684EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CNTFR Antibody, Biotin conjugated

1-CSB-PA005684ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human CellExp?CNTFR/CNTFR-alpha, human recombinant

7836-10
EUR 245

Human CellExp?CNTFR/CNTFR-alpha, human recombinant

7836-50
EUR 659

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse)

4-PAC185Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR)

CNTFR cloning plasmid

CSB-CL005684HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1119
  • Sequence: atggctgctcctgtcccgtgggcctgctgtgctgtgcttgccgccgccgccgcagttgtctacgcccagagacacagtccacaggaggcaccccatgtgcagtacgagcgcctgggctctgacgtgacactgccatgtgggacagcaaactgggatgctgcggtgacgtggcggg
  • Show more
Description: A cloning plasmid for the CNTFR gene.

CNTFR Blocking Peptide

33R-1094 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AMPH antibody, catalog no. 70R-3809

CNTFR Blocking Peptide

DF7058-BP 1mg
EUR 195

pOTB7-CNTFR Plasmid

PVTB00245S 2 ug
EUR 356

Human CNTFR Receptor alpha antibody

32512-05111 150 ug
EUR 261

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse)

4-PAC185Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR)

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), APC

4-PAC185Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), Biotinylated

4-PAC185Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Biotin.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), Cy3

4-PAC185Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Cy3.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), FITC

4-PAC185Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with FITC.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), HRP

4-PAC185Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with HRP.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), PE

4-PAC185Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with PE.

Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody

20-abx111682
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody

20-abx132422
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody

20-abx103900
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody

abx332127-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), APC

4-PAC185Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAC185Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Biotin.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), Cy3

4-PAC185Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Cy3.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), FITC

4-PAC185Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with FITC.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), HRP

4-PAC185Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with HRP.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), PE

4-PAC185Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with PE.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC185Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC-Cy7.

Rat CNTFR shRNA Plasmid

20-abx989755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CNTFR ELISA Kit

EHC0039 96Tests
EUR 521

Goat CNTFR ELISA Kit

EGTC0039 96Tests
EUR 521

Canine CNTFR ELISA Kit

ECC0039 96Tests
EUR 521

Chicken CNTFR ELISA Kit

ECKC0039 96Tests
EUR 521

Bovine CNTFR ELISA Kit

EBC0039 96Tests
EUR 521

Anserini CNTFR ELISA Kit

EAC0039 96Tests
EUR 521

Canine CNTFR ELISA KIT

ELI-10592d 96 Tests
EUR 928

CNTFR ELISA KIT|Human

EF008771 96 Tests
EUR 689

Rat CNTFR ELISA Kit

ERC0039 96Tests
EUR 521

Sheep CNTFR ELISA Kit

ESC0039 96Tests
EUR 521

Human CNTFR ELISA KIT

ELI-33667h 96 Tests
EUR 824

Mouse Cntfr ELISA KIT

ELI-46855m 96 Tests
EUR 865

Chicken CNTFR ELISA KIT

ELI-51012c 96 Tests
EUR 928

Porcine CNTFR ELISA Kit

EPC0039 96Tests
EUR 521

Mouse CNTFR ELISA Kit

EMC0039 96Tests
EUR 521

Monkey CNTFR ELISA Kit

EMKC0039 96Tests
EUR 521

Human CNTFR shRNA Plasmid

20-abx950891
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNTFR protein (His tag)

80R-4144 100 ug
EUR 327
Description: Recombinant Human CNTFR protein (His tag)

Mouse CNTFR shRNA Plasmid

20-abx969739
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAC185Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC-Cy7.

Human CNTFR Receptor alpha antibody (Biotin Conjugate)

32512-05121 150 ug
EUR 369

Guinea Pig CNTFR ELISA Kit

EGC0039 96Tests
EUR 521

CNTFR ORF Vector (Human) (pORF)

ORF002517 1.0 ug DNA
EUR 95

Cntfr ORF Vector (Rat) (pORF)

ORF065230 1.0 ug DNA
EUR 506

Cntfr ORF Vector (Mouse) (pORF)

ORF041711 1.0 ug DNA
EUR 506

Cntfr ORF Vector (Mouse) (pORF)

ORF041712 1.0 ug DNA
EUR 506

Cntfr ORF Vector (Mouse) (pORF)

ORF041713 1.0 ug DNA
EUR 506

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

20-abx002062
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

abx037435-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

abx038395-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

abx431175-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

20-abx302454
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

abx231820-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human CNTFR Receptor alpha AssayLite Antibody (FITC Conjugate)

32512-05141 150 ug
EUR 428

Human CNTFR Receptor alpha AssayLite Antibody (RPE Conjugate)

32512-05151 150 ug
EUR 428

Human CNTFR Receptor alpha AssayLite Antibody (APC Conjugate)

32512-05161 150 ug
EUR 428

Human CNTFR Receptor alpha AssayLite Antibody (PerCP Conjugate)

32512-05171 150 ug
EUR 471

CNTFR sgRNA CRISPR Lentivector set (Human)

K0478701 3 x 1.0 ug
EUR 339

Cntfr sgRNA CRISPR Lentivector set (Mouse)

K4998401 3 x 1.0 ug
EUR 339

Cntfr sgRNA CRISPR Lentivector set (Rat)

K7289901 3 x 1.0 ug
EUR 339

Recombinant Ciliary Neurotrophic Factor Receptor (CNTFR)

4-RPC185Hu01
  • EUR 474.53
  • EUR 230.00
  • EUR 1504.48
  • EUR 568.16
  • EUR 1036.32
  • EUR 380.00
  • EUR 3611.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P26992
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.3kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Ciliary Neurotrophic Factor Receptor expressed in: E.coli

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (HRP)

20-abx303457
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (FITC)

20-abx303458
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (Biotin)

20-abx303459
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CNTFR sgRNA CRISPR Lentivector (Human) (Target 1)

K0478702 1.0 ug DNA
EUR 154

CNTFR sgRNA CRISPR Lentivector (Human) (Target 2)

K0478703 1.0 ug DNA
EUR 154

CNTFR sgRNA CRISPR Lentivector (Human) (Target 3)

K0478704 1.0 ug DNA
EUR 154

Human Ciliary Neurotrophic Factor Receptor (CNTFR) Protein

20-abx065903
  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4998402 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4998403 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4998404 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Rat) (Target 1)

K7289902 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Rat) (Target 2)

K7289903 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Rat) (Target 3)

K7289904 1.0 ug DNA
EUR 154

CNTFR Protein Vector (Mouse) (pPB-C-His)

PV166842 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-N-His)

PV166843 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-HA)

PV166844 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-His)

PV166845 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-C-His)

PV166846 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-N-His)

PV166847 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-HA)

PV166848 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-His)

PV166849 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-C-His)

PV166850 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-N-His)

PV166851 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-HA)

PV166852 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-His)

PV166853 500 ng
EUR 603

Recombinant Human CNTFR Protein, His, E.coli-1mg

QP11474-1mg 1mg
EUR 2757

Recombinant Human CNTFR Protein, His, E.coli-25ug

QP11474-25ug 25ug
EUR 201

Recombinant Human CNTFR Protein, His, E.coli-5ug

QP11474-5ug 5ug
EUR 155

Recombinant Rat CNTFR Protein, His, Insect-1mg

QP11475-1mg 1mg
EUR 5251

Recombinant Rat CNTFR Protein, His, Insect-20ug

QP11475-20ug 20ug
EUR 201

Recombinant Rat CNTFR Protein, His, Insect-5ug

QP11475-5ug 5ug
EUR 155

CNTFR Protein Vector (Human) (pPB-C-His)

PV010065 500 ng
EUR 329

CNTFR Protein Vector (Human) (pPB-N-His)

PV010066 500 ng
EUR 329

CNTFR Protein Vector (Human) (pPM-C-HA)

PV010067 500 ng
EUR 329

CNTFR Protein Vector (Human) (pPM-C-His)

PV010068 500 ng
EUR 329

CNTFR Protein Vector (Rat) (pPB-C-His)

PV260918 500 ng
EUR 603

CNTFR Protein Vector (Rat) (pPB-N-His)

PV260919 500 ng
EUR 603

CNTFR Protein Vector (Rat) (pPM-C-HA)

PV260920 500 ng
EUR 603

CNTFR Protein Vector (Rat) (pPM-C-His)

PV260921 500 ng
EUR 603

Cntfr 3'UTR Luciferase Stable Cell Line

TU202574 1.0 ml Ask for price

Cntfr 3'UTR GFP Stable Cell Line

TU154129 1.0 ml Ask for price

CNTFR 3'UTR Luciferase Stable Cell Line

TU004721 1.0 ml
EUR 1521

Cntfr 3'UTR Luciferase Stable Cell Line

TU104129 1.0 ml Ask for price

CNTFR 3'UTR GFP Stable Cell Line

TU054721 1.0 ml
EUR 1521

Cntfr 3'UTR GFP Stable Cell Line

TU252574 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CNTFR Rabbit Polyclonal Antibody