DMA Rabbit Polyclonal Antibody

DMA Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

DMA Polyclonal Antibody
ES9711-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DMA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
DMA Polyclonal Antibody
ABP58389-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of DMA from Human. This DMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMA protein
DMA Polyclonal Antibody
ABP58389-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of DMA from Human. This DMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMA protein
DMA Polyclonal Antibody
ABP58389-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of DMA from Human. This DMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMA protein
HLA-DMA Polyclonal Antibody
A59378 100 µg
EUR 570.55
Description: Ask the seller for details
HLA-DMA Polyclonal Antibody
30759-100ul 100ul
EUR 252
HLA-DMA Polyclonal Antibody
30759-50ul 50ul
EUR 187
HLA-DMA Rabbit pAb
A6922-100ul 100 ul
EUR 308
HLA-DMA Rabbit pAb
A6922-200ul 200 ul
EUR 459
HLA-DMA Rabbit pAb
A6922-20ul 20 ul
EUR 183
HLA-DMA Rabbit pAb
A6922-50ul 50 ul
EUR 223
HLA-DMA Polyclonal Conjugated Antibody
C30759 100ul
EUR 397
DMA
HY-15621 5mg
EUR 133
HLA-DMA Polyclonal Antibody, Biotin Conjugated
A59379 100 µg
EUR 570.55
Description: The best epigenetics products
HLA-DMA Polyclonal Antibody, FITC Conjugated
A59380 100 µg
EUR 570.55
Description: kits suitable for this type of research
HLA-DMA Polyclonal Antibody, HRP Conjugated
A59381 100 µg
EUR 570.55
Description: fast delivery possible
HLA- DMA Antibody
ABD9572 100 ug
EUR 438
HLA-DMA antibody
22427-100ul 100ul
EUR 390
HLA-DMA Antibody
DF9572 200ul
EUR 304
Description: HLA-DMA Antibody detects endogenous levels of total HLA-DMA.
HLA-DMA Antibody
1-CSB-PA338892LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DMA. Recognizes HLA-DMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Anti-DMA antibody
STJ190869 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DMA
Human HLA-DMA protein (HLA-DMA)
1-CSB-EP338892HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human HLA-DMA protein(HLA-DMA),partial expressed in E.coli
DMA (trihydrochloride)
HY-15621A 10mM/1mL
EUR 156
anti- HLA-DMA antibody
FNab03900 100µg
EUR 548.75
  • Immunogen: major histocompatibility complex, class II, DM alpha
  • Uniprot ID: P28067
  • Research Area: Immunology
Description: Antibody raised against HLA-DMA
Anti-HLA-DMA antibody
PAab03900 100 ug
EUR 386
Anti-HLA-DMA antibody
STJ29002 100 µl
EUR 277
Description: HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail.
DLin-KC2-DMA
HY-112758 10mg
EUR 452
anti-HLA-DMA
YF-PA27245 50 ug
EUR 363
Description: Mouse polyclonal to HLA-DMA
HLA-DMA Antibody, HRP conjugated
1-CSB-PA338892LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DMA. Recognizes HLA-DMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
HLA-DMA Antibody, FITC conjugated
1-CSB-PA338892LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DMA. Recognizes HLA-DMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
HLA-DMA Antibody, Biotin conjugated
1-CSB-PA338892LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HLA-DMA. Recognizes HLA-DMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
HLA-DMA cloning plasmid
CSB-CL338892HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 786
  • Sequence: atgggtcatgaacagaaccaaggagctgcgctgctacagatgttaccacttctgtggctgctaccccactcctgggccgtccctgaagctcctactccaatgtggccagatgacctgcaaaaccacacattcctgcacacagtgtactgccaggatgggagtcccagtgtgggact
  • Show more
Description: A cloning plasmid for the HLA-DMA gene.
D-Lin-MC3-DMA
HY-112251 10mg
EUR 223
HLA-DMA Blocking Peptide
DF9572-BP 1mg
EUR 195
HLA-DMA ELISA KIT|Human
EF010141 96 Tests
EUR 689
Human HLA-DMA ELISA KIT
ELI-32812h 96 Tests
EUR 824
Mouse H2-DMa ELISA KIT
ELI-48823m 96 Tests
EUR 865
HLA-DMA Recombinant Protein (Human)
RP014851 100 ug Ask for price
RT1-DMa Recombinant Protein (Rat)
RP227117 100 ug Ask for price
H2-DMa Recombinant Protein (Mouse)
RP140675 100 ug Ask for price
HLA-DMA ORF Vector (Human) (pORF)
ORF004951 1.0 ug DNA
EUR 95
RT1-DMa ORF Vector (Rat) (pORF)
ORF075707 1.0 ug DNA
EUR 506
H2-DMa ORF Vector (Mouse) (pORF)
ORF046893 1.0 ug DNA
EUR 506
HLA-DMA ELISA Kit (Human) (OKEH03352)
OKEH03352 96 Wells
EUR 779
Description: Description of target: Plays a critical role in catalyzing the release of class II-associated invariant chain peptide (CLIP) from newly synthesized MHC class II molecules and freeing the peptide binding site for acquisition of antigenic peptides. In B-cells, the interaction between HLA-DM and MHC class II molecules is regulated by HLA-DO.3 Publications;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.186 ng/mL
Monoclonal HLA-DMA Antibody (monoclonal) (M01), Clone: 3F12-F11
AMM03623G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HLA-DMA (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F12-F11. This antibody is applicable in WB and IHC, E
Anti-TPBG (clone A1)-SMCC-DMA ADC
ADC-W-005 1mg Ask for price
Description: This ADC product is comprised of an anti-TPBG monoclonal antibody (clone A1) conjugated via a SMCC linker to DMA
HLA-DMA sgRNA CRISPR Lentivector set (Human)
K0963701 3 x 1.0 ug
EUR 339
RT1-DMa sgRNA CRISPR Lentivector set (Rat)
K7433601 3 x 1.0 ug
EUR 339
H2-DMa sgRNA CRISPR Lentivector set (Mouse)
K3796001 3 x 1.0 ug
EUR 339
HLA-DMA sgRNA CRISPR Lentivector (Human) (Target 1)
K0963702 1.0 ug DNA
EUR 154
HLA-DMA sgRNA CRISPR Lentivector (Human) (Target 2)
K0963703 1.0 ug DNA
EUR 154
HLA-DMA sgRNA CRISPR Lentivector (Human) (Target 3)
K0963704 1.0 ug DNA
EUR 154
RT1-DMa sgRNA CRISPR Lentivector (Rat) (Target 1)
K7433602 1.0 ug DNA
EUR 154
RT1-DMa sgRNA CRISPR Lentivector (Rat) (Target 2)
K7433603 1.0 ug DNA
EUR 154
RT1-DMa sgRNA CRISPR Lentivector (Rat) (Target 3)
K7433604 1.0 ug DNA
EUR 154
H2-DMa sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3796002 1.0 ug DNA
EUR 154
H2-DMa sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3796003 1.0 ug DNA
EUR 154
H2-DMa sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3796004 1.0 ug DNA
EUR 154
Recombinant Human HLA-DMA Protein, His, E.coli-100ug
QP7191-ec-100ug 100ug
EUR 408
Recombinant Human HLA-DMA Protein, His, E.coli-10ug
QP7191-ec-10ug 10ug
EUR 200
Recombinant Human HLA-DMA Protein, His, E.coli-1mg
QP7191-ec-1mg 1mg
EUR 1632
Recombinant Human HLA-DMA Protein, His, E.coli-200ug
QP7191-ec-200ug 200ug
EUR 634
Recombinant Human HLA-DMA Protein, His, E.coli-500ug
QP7191-ec-500ug 500ug
EUR 1060
Recombinant Human HLA-DMA Protein, His, E.coli-50ug
QP7191-ec-50ug 50ug
EUR 263
HLA-DMA Protein Vector (Human) (pPB-C-His)
PV019801 500 ng
EUR 329
HLA-DMA Protein Vector (Human) (pPB-N-His)
PV019802 500 ng
EUR 329
HLA-DMA Protein Vector (Human) (pPM-C-HA)
PV019803 500 ng
EUR 329
HLA-DMA Protein Vector (Human) (pPM-C-His)
PV019804 500 ng
EUR 329
H2-DMa Protein Vector (Mouse) (pPB-C-His)
PV187570 500 ng
EUR 603
H2-DMa Protein Vector (Mouse) (pPB-N-His)
PV187571 500 ng
EUR 603
H2-DMa Protein Vector (Mouse) (pPM-C-HA)
PV187572 500 ng
EUR 603
H2-DMa Protein Vector (Mouse) (pPM-C-His)
PV187573 500 ng
EUR 603
RT1-DMa Protein Vector (Rat) (pPB-C-His)
PV302826 500 ng
EUR 603
RT1-DMa Protein Vector (Rat) (pPB-N-His)
PV302827 500 ng
EUR 603
RT1-DMa Protein Vector (Rat) (pPM-C-HA)
PV302828 500 ng
EUR 603
RT1-DMa Protein Vector (Rat) (pPM-C-His)
PV302829 500 ng
EUR 603
H2-DMa 3'UTR GFP Stable Cell Line
TU159279 1.0 ml Ask for price
HLA-DMA 3'UTR Luciferase Stable Cell Line
TU009899 1.0 ml
EUR 1394
H2-DMa 3'UTR Luciferase Stable Cell Line
TU109279 1.0 ml Ask for price
HLA-DMA 3'UTR GFP Stable Cell Line
TU059899 1.0 ml
EUR 1394
RT1-DMa 3'UTR Luciferase Stable Cell Line
TU219791 1.0 ml Ask for price
RT1-DMa 3'UTR GFP Stable Cell Line
TU269791 1.0 ml Ask for price
HLA Class II Histocompatibility Antigen, DM Alpha Chain (HLA-DMA) Antibody
abx145236-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
HLA Class II Histocompatibility Antigen, DM Alpha Chain (HLA-DMA) Antibody
20-abx006629
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
HLA Class II Histocompatibility Antigen, DM Alpha Chain (HLA-DMA) Antibody
20-abx306628
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
HLA Class II Histocompatibility Antigen, DM Alpha Chain (HLA-DMA) Antibody
abx233900-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

DMA Rabbit Polyclonal Antibody