EDEM3 Rabbit Polyclonal Antibody

EDEM3 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

EDEM3 Polyclonal Antibody

ABP58454-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody

ABP58454-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody

ABP58454-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Antibody

ABD9504 100 ug
EUR 438

EDEM3 Antibody

45972-100ul 100ul
EUR 252

EDEM3 Antibody

45972-50ul 50ul
EUR 187

EDEM3 Antibody

DF9504 200ul
EUR 304
Description: EDEM3 Antibody detects endogenous levels of total EDEM3.

EDEM3 Conjugated Antibody

C45972 100ul
EUR 397

Anti-EDEM3 antibody

STJ190807 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EDEM3

EDEM3 siRNA

20-abx914952
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDEM3 siRNA

20-abx914953
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDEM3 Blocking Peptide

3614BP-50
EUR 153

EDEM3 cloning plasmid

CSB-CL863170HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggcca
  • Show more
Description: A cloning plasmid for the EDEM3 gene.

EDEM3 Blocking Peptide

DF9504-BP 1mg
EUR 195

Mouse EDEM3 shRNA Plasmid

20-abx975889
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EDEM3 shRNA Plasmid

20-abx962830
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Edem3 ELISA KIT

ELI-26645m 96 Tests
EUR 865

Human EDEM3 ELISA KIT

ELI-47172h 96 Tests
EUR 824

EDEM3 ORF Vector (Human) (pORF)

ORF003388 1.0 ug DNA
EUR 95

Edem3 ORF Vector (Rat) (pORF)

ORF066352 1.0 ug DNA
EUR 506

Edem3 ORF Vector (Mouse) (pORF)

ORF043621 1.0 ug DNA
EUR 506

EDEM3 sgRNA CRISPR Lentivector set (Human)

K0653601 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Mouse)

K3468201 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Rat)

K6190401 3 x 1.0 ug
EUR 339

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0653602 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0653603 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0653604 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3468202 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3468203 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3468204 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6190402 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6190403 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6190404 1.0 ug DNA
EUR 154

EDEM3 Protein Vector (Mouse) (pPB-C-His)

PV174482 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPB-N-His)

PV174483 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-HA)

PV174484 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-His)

PV174485 500 ng
EUR 1065

EDEM3 Protein Vector (Human) (pPB-C-His)

PV013549 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPB-N-His)

PV013550 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-HA)

PV013551 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-His)

PV013552 500 ng
EUR 329

EDEM3 Protein Vector (Rat) (pPB-C-His)

PV265406 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPB-N-His)

PV265407 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-HA)

PV265408 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-His)

PV265409 500 ng
EUR 1166

Edem3 3'UTR Luciferase Stable Cell Line

TU203778 1.0 ml Ask for price

Edem3 3'UTR GFP Stable Cell Line

TU155599 1.0 ml Ask for price

EDEM3 3'UTR Luciferase Stable Cell Line

TU006561 1.0 ml
EUR 2333

Edem3 3'UTR Luciferase Stable Cell Line

TU105599 1.0 ml Ask for price

EDEM3 3'UTR GFP Stable Cell Line

TU056561 1.0 ml
EUR 2333

Edem3 3'UTR GFP Stable Cell Line

TU253778 1.0 ml Ask for price

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

20-abx215068
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

EDEM3 Rabbit Polyclonal Antibody