EDEM3 Rabbit Polyclonal Antibody
EDEM3 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 EDEM3 Polyclonal Antibody |
|
ABP58454-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein |
EDEM3 Polyclonal Antibody |
|
ABP58454-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein |
EDEM3 Polyclonal Antibody |
|
ABP58454-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein |
 EDEM3 Antibody |
|
45972-100ul |
SAB |
100ul |
EUR 252 |
EDEM3 Antibody |
|
45972-50ul |
SAB |
50ul |
EUR 187 |
EDEM3 Antibody |
|
DF9504 |
Affbiotech |
200ul |
EUR 304 |
|
Description: EDEM3 Antibody detects endogenous levels of total EDEM3. |
 EDEM3 Conjugated Antibody |
|
C45972 |
SAB |
100ul |
EUR 397 |
 Anti-EDEM3 antibody |
|
STJ190807 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to EDEM3 |
 EDEM3 siRNA |
|
20-abx914952 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EDEM3 siRNA |
|
20-abx914953 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 EDEM3 Blocking Peptide |
|
3614BP-50 |
Biovision |
|
EUR 153 |
 EDEM3 cloning plasmid |
|
CSB-CL863170HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 369
- Sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggcca
- Show more
|
|
Description: A cloning plasmid for the EDEM3 gene. |
EDEM3 Blocking Peptide |
|
DF9504-BP |
Affbiotech |
1mg |
EUR 195 |
 Mouse EDEM3 shRNA Plasmid |
|
20-abx975889 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human EDEM3 shRNA Plasmid |
|
20-abx962830 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (pORF)) EDEM3 ORF Vector (Human) (pORF) |
|
ORF003388 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Edem3 ORF Vector (Rat) (pORF) |
|
ORF066352 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Edem3 ORF Vector (Mouse) (pORF) |
|
ORF043621 |
ABM |
1.0 ug DNA |
EUR 506 |
) EDEM3 sgRNA CRISPR Lentivector set (Human) |
|
K0653601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Edem3 sgRNA CRISPR Lentivector set (Mouse) |
|
K3468201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Edem3 sgRNA CRISPR Lentivector set (Rat) |
|
K6190401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) EDEM3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0653602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) EDEM3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0653603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) EDEM3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0653604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3468202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3468203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3468204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Edem3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6190402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Edem3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6190403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Edem3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6190404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) EDEM3 Protein Vector (Mouse) (pPB-C-His) |
|
PV174482 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) EDEM3 Protein Vector (Mouse) (pPB-N-His) |
|
PV174483 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) EDEM3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV174484 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) EDEM3 Protein Vector (Mouse) (pPM-C-His) |
|
PV174485 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) EDEM3 Protein Vector (Human) (pPB-C-His) |
|
PV013549 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) EDEM3 Protein Vector (Human) (pPB-N-His) |
|
PV013550 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) EDEM3 Protein Vector (Human) (pPM-C-HA) |
|
PV013551 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) EDEM3 Protein Vector (Human) (pPM-C-His) |
|
PV013552 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) EDEM3 Protein Vector (Rat) (pPB-C-His) |
|
PV265406 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) EDEM3 Protein Vector (Rat) (pPB-N-His) |
|
PV265407 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) EDEM3 Protein Vector (Rat) (pPM-C-HA) |
|
PV265408 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) EDEM3 Protein Vector (Rat) (pPM-C-His) |
|
PV265409 |
ABM |
500 ng |
EUR 1166 |
 Edem3 3'UTR Luciferase Stable Cell Line |
|
TU203778 |
ABM |
1.0 ml |
Ask for price |
 Edem3 3'UTR GFP Stable Cell Line |
|
TU155599 |
ABM |
1.0 ml |
Ask for price |
 EDEM3 3'UTR Luciferase Stable Cell Line |
|
TU006561 |
ABM |
1.0 ml |
EUR 2333 |
Edem3 3'UTR Luciferase Stable Cell Line |
|
TU105599 |
ABM |
1.0 ml |
Ask for price |
 EDEM3 3'UTR GFP Stable Cell Line |
|
TU056561 |
ABM |
1.0 ml |
EUR 2333 |
Edem3 3'UTR GFP Stable Cell Line |
|
TU253778 |
ABM |
1.0 ml |
Ask for price |
 Antibody) ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody |
|
abx028901-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody |
|
abx028901-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody |
|
20-abx215068 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
EDEM3 Rabbit Polyclonal Antibody
