EIF3A Rabbit Polyclonal Antibody

EIF3A Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

EIF3A Polyclonal Antibody
ABP58469-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EIF3A protein
  • Applications tips:
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein

EIF3A Polyclonal Antibody
ABP58469-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EIF3A protein
  • Applications tips:
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein

EIF3A Polyclonal Antibody
ABP58469-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EIF3A protein
  • Applications tips:
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein

EIF3A Rabbit pAb
A0573-100ul 100 ul
EUR 308

EIF3A Rabbit pAb
A0573-200ul 200 ul
EUR 459

EIF3A Rabbit pAb
A0573-20ul 20 ul
EUR 183

EIF3A Rabbit pAb
A0573-50ul 50 ul
EUR 223

EIF3A Antibody
ABD9510 100 ug
EUR 438

EIF3A Antibody
45975-100ul 100ul
EUR 252

EIF3A Antibody
45975-50ul 50ul
EUR 187

EIF3A Antibody
DF9510 200ul
EUR 304
Description: EIF3A Antibody detects endogenous levels of total EIF3A.

EIF3A Antibody
1-CSB-PA623903LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

Rabbit EIF3A ELISA Kit
ERTE0054 96Tests
EUR 521

EIF3A Conjugated Antibody
C45975 100ul
EUR 397

Anti-EIF3A antibody
STJ29809 100 µl
EUR 277

Anti-EIF3A antibody
STJ190814 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EIF3A

Eif3a/ Rat Eif3a ELISA Kit
ELI-06048r 96 Tests
EUR 886

EIF3A siRNA
20-abx901678
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3A siRNA
20-abx915160
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3A siRNA
20-abx915161
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-Eif3a
YF-PA25156 50 ul
EUR 334
Description: Mouse polyclonal to Eif3a

EIF3A Antibody, HRP conjugated
1-CSB-PA623903LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EIF3A Antibody, FITC conjugated
1-CSB-PA623903LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EIF3A Antibody, Biotin conjugated
1-CSB-PA623903LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EIF3A Blocking Peptide
DF9510-BP 1mg
EUR 195

EIF3A cloning plasmid
CSB-CL623903HU-10ug 10ug
EUR 1629
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4149
  • Sequence: ATGCCGGCCTATTTTCAGAGGCCGGAAAATGCCCTCAAACGCGCCAACGAATTTCTTGAGGTTGGCAAAAAGCAGCCTGCTCTGGATGTTCTTTATGATGTTATGAAAAGTAAAAAACATAGAACATGGCAAAAGATACACGAACCAATTATGTTGAAATACTTGGAACTTTGCG
  • Show more
Description: A cloning plasmid for the EIF3A gene.

Anti-Eif3a (2G4)
YF-MA16469 100 ug
EUR 363
Description: Mouse monoclonal to Eif3a

Rat EIF3A shRNA Plasmid
20-abx988556
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF3A ELISA Kit
EHE0054 96Tests
EUR 521

Human EIF3A ELISA Kit
ELA-E1885h 96 Tests
EUR 824

Goat EIF3A ELISA Kit
EGTE0054 96Tests
EUR 521

Canine EIF3A ELISA Kit
ECE0054 96Tests
EUR 521

Bovine EIF3A ELISA Kit
EBE0054 96Tests
EUR 521

Anserini EIF3A ELISA Kit
EAE0054 96Tests
EUR 521

Mouse Eif3a ELISA KIT
ELI-06046m 96 Tests
EUR 865

Human EIF3A ELISA KIT
ELI-06047h 96 Tests
EUR 824

EIF3A ELISA KIT|Human
EF006084 96 Tests
EUR 689

Porcine EIF3A ELISA Kit
EPE0054 96Tests
EUR 521

Rat EIF3A ELISA Kit
ERE0054 96Tests
EUR 521

Mouse EIF3A ELISA Kit
EME0054 96Tests
EUR 521

Human EIF3A shRNA Plasmid
20-abx955696
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF3A shRNA Plasmid
20-abx970142
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse)
4-PAB885Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EIF3A (Glu622~Val848)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A)

Rabbit Eukaryotic Translation Initiation Factor 3a (eIF3a) ELISA Kit
abx363133-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), APC
4-PAB885Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EIF3A (Glu622~Val848)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with APC.

Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAB885Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EIF3A (Glu622~Val848)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with Biotin.

Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), Cy3
4-PAB885Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EIF3A (Glu622~Val848)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with Cy3.

Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), FITC
4-PAB885Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EIF3A (Glu622~Val848)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with FITC.

Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), HRP
4-PAB885Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EIF3A (Glu622~Val848)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with HRP.

Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), PE
4-PAB885Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EIF3A (Glu622~Val848)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with PE.

Eukaryotic Translation Initiation Factor 3A (EIF3A) Antibody
20-abx104335
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx005944
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx215114
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx302524
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody
20-abx225157
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Guinea Pig EIF3A ELISA Kit
EGE0054 96Tests
EUR 521

Eif3a ORF Vector (Rat) (pORF)
ORF066448 1.0 ug DNA
EUR 2080

Eif3a ORF Vector (Mouse) (pORF)
ORF043757 1.0 ug DNA
EUR 1572

EIF3A ORF Vector (Human) (pORF)
ORF012910 1.0 ug DNA
EUR 354

EIF3A ELISA Kit (Human) (OKEH01347)
OKEH01347 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23 ng/mL

EIF3A ELISA Kit (Mouse) (OKEI00448)
OKEI00448 96 Wells
EUR 767
Description: Description of target: RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL

Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAB885Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EIF3A (Glu622~Val848)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with APC-Cy7.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody (HRP)
20-abx317408
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody (FITC)
20-abx317409
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody (Biotin)
20-abx317410
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EIF3A sgRNA CRISPR Lentivector set (Human)
K0667001 3 x 1.0 ug
EUR 339

Eif3a sgRNA CRISPR Lentivector set (Mouse)
K3834701 3 x 1.0 ug
EUR 339

Eif3a sgRNA CRISPR Lentivector set (Rat)
K6605701 3 x 1.0 ug
EUR 339

EIF3A sgRNA CRISPR Lentivector (Human) (Target 1)
K0667002 1.0 ug DNA
EUR 154

EIF3A sgRNA CRISPR Lentivector (Human) (Target 2)
K0667003 1.0 ug DNA
EUR 154

EIF3A sgRNA CRISPR Lentivector (Human) (Target 3)
K0667004 1.0 ug DNA
EUR 154

Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3834702 1.0 ug DNA
EUR 154

Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3834703 1.0 ug DNA
EUR 154

Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3834704 1.0 ug DNA
EUR 154

Eif3a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6605702 1.0 ug DNA
EUR 154

Eif3a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6605703 1.0 ug DNA
EUR 154

Eif3a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6605704 1.0 ug DNA
EUR 154

EIF3A Protein Vector (Human) (pPB-C-His)
PV051637 500 ng
EUR 481

EIF3A Protein Vector (Human) (pPB-N-His)
PV051638 500 ng
EUR 481

EIF3A Protein Vector (Human) (pPM-C-HA)
PV051639 500 ng
EUR 481

EIF3A Protein Vector (Human) (pPM-C-His)
PV051640 500 ng
EUR 481

Recombinant Eukaryotic Translation Initiation Factor 3A (EIF3A)
4-RPB885Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23116
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.3kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Eukaryotic Translation Initiation Factor 3A expressed in: E.coli

EIF3A Protein Vector (Mouse) (pPB-C-His)
PV175026 500 ng
EUR 2300

EIF3A Protein Vector (Mouse) (pPB-N-His)
PV175027 500 ng
EUR 2300

EIF3A Protein Vector (Mouse) (pPM-C-HA)
PV175028 500 ng
EUR 2300

EIF3A Protein Vector (Mouse) (pPM-C-His)
PV175029 500 ng
EUR 2300

EIF3A Protein Vector (Rat) (pPB-C-His)
PV265790 500 ng
EUR 2315

EIF3A Protein Vector (Rat) (pPB-N-His)
PV265791 500 ng
EUR 2315

EIF3A Protein Vector (Rat) (pPM-C-HA)
PV265792 500 ng
EUR 2315

EIF3A Protein Vector (Rat) (pPM-C-His)
PV265793 500 ng
EUR 2315

Eif3a 3'UTR Luciferase Stable Cell Line
TU203880 1.0 ml Ask for price

Eif3a 3'UTR GFP Stable Cell Line
TU155713 1.0 ml Ask for price

EIF3A 3'UTR Luciferase Stable Cell Line
TU006728 1.0 ml
EUR 1394

Eif3a 3'UTR Luciferase Stable Cell Line
TU105713 1.0 ml Ask for price

EIF3A 3'UTR GFP Stable Cell Line
TU056728 1.0 ml
EUR 1394

Eif3a 3'UTR GFP Stable Cell Line
TU253880 1.0 ml Ask for price

Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A) Protein
20-abx066468
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

EIF3A Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV704469 1.0 ug DNA
EUR 450

EIF3A Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV704473 1.0 ug DNA
EUR 450

EIF3A Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV704474 1.0 ug DNA
EUR 450

EIF3A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV689131 1.0 ug DNA
EUR 2168

EIF3A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV689135 1.0 ug DNA
EUR 2168

EIF3A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV689136 1.0 ug DNA
EUR 2168

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

EIF3A Rabbit Polyclonal Antibody

Site Title, Some rights reserved.

Terms of Use - Privacy Policy

WordPress Di Business Theme