FANCM Rabbit Polyclonal Antibody
FANCM Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 FANCM Polyclonal Antibody |
|
ES9658-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against FANCM from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 FANCM Rabbit pAb |
|
A7602-100ul |
Abclonal |
100 ul |
EUR 308 |
FANCM Rabbit pAb |
|
A7602-200ul |
Abclonal |
200 ul |
EUR 459 |
FANCM Rabbit pAb |
|
A7602-20ul |
Abclonal |
20 ul |
EUR 183 |
FANCM Rabbit pAb |
|
A7602-50ul |
Abclonal |
50 ul |
EUR 223 |
 FANCM antibody |
|
70R-17238 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal FANCM antibody |
FANCM antibody |
|
10-2525 |
Fitzgerald |
250 ug |
EUR 492 |
|
Description: Mouse monoclonal FANCM antibody |
 FANCM Antibody |
|
45977-100ul |
SAB |
100ul |
EUR 252 |
FANCM Antibody |
|
45977-50ul |
SAB |
50ul |
EUR 187 |
FANCM Antibody |
|
1-CSB-PA810301ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FANCM. Recognizes FANCM from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
FANCM Antibody |
|
DF9513 |
Affbiotech |
200ul |
EUR 304 |
|
Description: FANCM Antibody detects endogenous levels of total FANCM. |
FANCM Antibody |
|
1-CSB-PA008422GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FANCM. Recognizes FANCM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 FANCM Conjugated Antibody |
|
C45977 |
SAB |
100ul |
EUR 397 |
 anti- FANCM antibody |
|
FNab03012 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: Fanconi anemia, complementation group M
- Uniprot ID: Q8IYD8
- Gene ID: 57697
- Research Area: Epigenetics, Metabolism
|
|
Description: Antibody raised against FANCM |
 Anti-FANCM antibody |
|
STJ29739 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. |
Anti-FANCM antibody |
|
STJ190816 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to FANCM |
 FANCM siRNA |
|
20-abx916476 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FANCM siRNA |
|
20-abx916477 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-FANCM |
|
YF-PA20264 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to FANCM |
 FANCM Blocking Peptide |
|
DF9513-BP |
Affbiotech |
1mg |
EUR 195 |
 FANCM cloning plasmid |
|
CSB-CL810301HU-10ug |
Cusabio |
10ug |
EUR 672 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2010
- Sequence: atgagcggacggcaaagaacgctttttcagacgtggggctcaagtatctcccgatcatctgggactccgggttgcagctccggaactgagcgacctcagagccctggcagctccaaggcgcctttgccagcagcagcggaggctcagctggagtcggacgatgatgtgttgcttg
- Show more
|
|
Description: A cloning plasmid for the FANCM gene. |
 Mouse FANCM shRNA Plasmid |
|
20-abx979662 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human FANCM shRNA Plasmid |
|
20-abx961639 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
20-abx006242 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
20-abx215299 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
20-abx112462 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
abx146034-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
20-abx321750 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
abx432676-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
abx233012-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 (pORF)) FANCM ORF Vector (Human) (pORF) |
|
ORF003921 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Fancm ORF Vector (Mouse) (pORF) |
|
ORF044581 |
ABM |
1.0 ug DNA |
EUR 2204 |
) Fancm sgRNA CRISPR Lentivector set (Mouse) |
|
K4548801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) FANCM sgRNA CRISPR Lentivector set (Human) |
|
K0757401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Fancm sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4548802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Fancm sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4548803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Fancm sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4548804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) FANCM sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0757402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) FANCM sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0757403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) FANCM sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0757404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) FANCM Protein Vector (Mouse) (pPB-C-His) |
|
PV178322 |
ABM |
500 ng |
EUR 3331 |
 (pPB-N-His)) FANCM Protein Vector (Mouse) (pPB-N-His) |
|
PV178323 |
ABM |
500 ng |
EUR 3331 |
 (pPM-C-HA)) FANCM Protein Vector (Mouse) (pPM-C-HA) |
|
PV178324 |
ABM |
500 ng |
EUR 3331 |
 (pPM-C-His)) FANCM Protein Vector (Mouse) (pPM-C-His) |
|
PV178325 |
ABM |
500 ng |
EUR 3331 |
 (pPB-C-His)) FANCM Protein Vector (Human) (pPB-C-His) |
|
PV015681 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) FANCM Protein Vector (Human) (pPB-N-His) |
|
PV015682 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) FANCM Protein Vector (Human) (pPM-C-HA) |
|
PV015683 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) FANCM Protein Vector (Human) (pPM-C-His) |
|
PV015684 |
ABM |
500 ng |
EUR 329 |
 Fancm 3'UTR GFP Stable Cell Line |
|
TU156354 |
ABM |
1.0 ml |
Ask for price |
 Fancm 3'UTR Luciferase Stable Cell Line |
|
TU106354 |
ABM |
1.0 ml |
Ask for price |
 FANCM 3'UTR GFP Stable Cell Line |
|
TU057709 |
ABM |
1.0 ml |
EUR 1394 |
 FANCM 3'UTR Luciferase Stable Cell Line |
|
TU007709 |
ABM |
1.0 ml |
EUR 1394 |
 ELISA Kit) Human Fanconi Anemia Complementation Group M (FANCM) ELISA Kit |
|
abx387299-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Fanconi Anemia Complementation Group M (FANCM) ELISA Kit |
|
abx389244-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Human Fanconi anemia group M protein, FANCM ELISA KIT |
|
ELI-48578h |
Lifescience Market |
96 Tests |
EUR 824 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
FANCM Rabbit Polyclonal Antibody
