FANCM Rabbit Polyclonal Antibody
FANCM Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 FANCM Polyclonal Antibody |
|
ABP58528-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FANCM protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of FANCM from Human. This FANCM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FANCM protein |
 FANCM Rabbit pAb |
|
A7602-100ul |
Abclonal |
100 ul |
EUR 308 |
FANCM Rabbit pAb |
|
A7602-200ul |
Abclonal |
200 ul |
EUR 459 |
FANCM Rabbit pAb |
|
A7602-20ul |
Abclonal |
20 ul |
EUR 183 |
FANCM Rabbit pAb |
|
A7602-50ul |
Abclonal |
50 ul |
EUR 223 |
 FANCM Antibody |
|
45977-100ul |
SAB |
100ul |
EUR 252 |
FANCM Antibody |
|
45977-50ul |
SAB |
50ul |
EUR 187 |
 FANCM antibody |
|
10-2525 |
Fitzgerald |
250 ug |
EUR 492 |
|
Description: Mouse monoclonal FANCM antibody |
FANCM antibody |
|
70R-17238 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal FANCM antibody |
FANCM Antibody |
|
DF9513 |
Affbiotech |
200ul |
EUR 304 |
|
Description: FANCM Antibody detects endogenous levels of total FANCM. |
FANCM Antibody |
|
1-CSB-PA008422GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FANCM. Recognizes FANCM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
FANCM Antibody |
|
1-CSB-PA810301ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FANCM. Recognizes FANCM from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
 FANCM Conjugated Antibody |
|
C45977 |
SAB |
100ul |
EUR 397 |
 anti- FANCM antibody |
|
FNab03012 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: Fanconi anemia, complementation group M
- Uniprot ID: Q8IYD8
- Gene ID: 57697
- Research Area: Epigenetics, Metabolism
|
|
Description: Antibody raised against FANCM |
 Anti-FANCM antibody |
|
STJ29739 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. |
Anti-FANCM antibody |
|
STJ190816 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to FANCM |
 FANCM siRNA |
|
20-abx916476 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FANCM siRNA |
|
20-abx916477 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-FANCM |
|
YF-PA20264 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to FANCM |
 FANCM Blocking Peptide |
|
DF9513-BP |
Affbiotech |
1mg |
EUR 195 |
 FANCM cloning plasmid |
|
CSB-CL810301HU-10ug |
Cusabio |
10ug |
EUR 672 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2010
- Sequence: atgagcggacggcaaagaacgctttttcagacgtggggctcaagtatctcccgatcatctgggactccgggttgcagctccggaactgagcgacctcagagccctggcagctccaaggcgcctttgccagcagcagcggaggctcagctggagtcggacgatgatgtgttgcttg
- Show more
|
|
Description: A cloning plasmid for the FANCM gene. |
 Mouse FANCM shRNA Plasmid |
|
20-abx979662 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human FANCM shRNA Plasmid |
|
20-abx961639 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
20-abx112462 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
abx146034-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
20-abx006242 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
20-abx321750 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
20-abx215299 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
abx432676-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Fanconi Anemia Complementation Group M (FANCM) Antibody |
|
abx233012-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 (pORF)) FANCM ORF Vector (Human) (pORF) |
|
ORF003921 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Fancm ORF Vector (Mouse) (pORF) |
|
ORF044581 |
ABM |
1.0 ug DNA |
EUR 2204 |
) FANCM sgRNA CRISPR Lentivector set (Human) |
|
K0757401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Fancm sgRNA CRISPR Lentivector set (Mouse) |
|
K4548801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) FANCM sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0757402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) FANCM sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0757403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) FANCM sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0757404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Fancm sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4548802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Fancm sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4548803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Fancm sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4548804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) FANCM Protein Vector (Mouse) (pPB-C-His) |
|
PV178322 |
ABM |
500 ng |
EUR 3331 |
 (pPB-N-His)) FANCM Protein Vector (Mouse) (pPB-N-His) |
|
PV178323 |
ABM |
500 ng |
EUR 3331 |
 (pPM-C-HA)) FANCM Protein Vector (Mouse) (pPM-C-HA) |
|
PV178324 |
ABM |
500 ng |
EUR 3331 |
 (pPM-C-His)) FANCM Protein Vector (Mouse) (pPM-C-His) |
|
PV178325 |
ABM |
500 ng |
EUR 3331 |
 (pPB-C-His)) FANCM Protein Vector (Human) (pPB-C-His) |
|
PV015681 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) FANCM Protein Vector (Human) (pPB-N-His) |
|
PV015682 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) FANCM Protein Vector (Human) (pPM-C-HA) |
|
PV015683 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) FANCM Protein Vector (Human) (pPM-C-His) |
|
PV015684 |
ABM |
500 ng |
EUR 329 |
 Fancm 3'UTR GFP Stable Cell Line |
|
TU156354 |
ABM |
1.0 ml |
Ask for price |
 FANCM 3'UTR Luciferase Stable Cell Line |
|
TU007709 |
ABM |
1.0 ml |
EUR 1394 |
 Fancm 3'UTR Luciferase Stable Cell Line |
|
TU106354 |
ABM |
1.0 ml |
Ask for price |
 FANCM 3'UTR GFP Stable Cell Line |
|
TU057709 |
ABM |
1.0 ml |
EUR 1394 |
 Human Fanconi anemia group M protein, FANCM ELISA KIT |
|
ELI-48578h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit) Human Fanconi Anemia Complementation Group M (FANCM) ELISA Kit |
|
abx387299-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Fanconi Anemia Complementation Group M (FANCM) ELISA Kit |
|
abx389244-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
FANCM Rabbit Polyclonal Antibody
