FANCM Rabbit Polyclonal Antibody

FANCM Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

FANCM Polyclonal Antibody

ABP58528-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FANCM protein
  • Applications tips:
Description: A polyclonal antibody for detection of FANCM from Human. This FANCM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FANCM protein

FANCM Rabbit pAb

A7602-100ul 100 ul
EUR 308

FANCM Rabbit pAb

A7602-200ul 200 ul
EUR 459

FANCM Rabbit pAb

A7602-20ul 20 ul
EUR 183

FANCM Rabbit pAb

A7602-50ul 50 ul
EUR 223

FANCM Antibody

ABD9513 100 ug
EUR 438

FANCM Antibody

45977-100ul 100ul
EUR 252

FANCM Antibody

45977-50ul 50ul
EUR 187

FANCM antibody

10-2525 250 ug
EUR 492
Description: Mouse monoclonal FANCM antibody

FANCM antibody

70R-17238 50 ul
EUR 435
Description: Rabbit polyclonal FANCM antibody

FANCM Antibody

DF9513 200ul
EUR 304
Description: FANCM Antibody detects endogenous levels of total FANCM.

FANCM Antibody

1-CSB-PA008422GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FANCM. Recognizes FANCM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FANCM Antibody

1-CSB-PA810301ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FANCM. Recognizes FANCM from Human. This antibody is Unconjugated. Tested in the following application: ELISA

FANCM Conjugated Antibody

C45977 100ul
EUR 397

anti- FANCM antibody

FNab03012 100µg
EUR 548.75
  • Immunogen: Fanconi anemia, complementation group M
  • Uniprot ID: Q8IYD8
  • Gene ID: 57697
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against FANCM

Anti-FANCM antibody

PAab03012 100 ug
EUR 386

Anti-FANCM antibody

STJ72222 100 µg
EUR 260

Anti-FANCM antibody

STJ29739 100 µl
EUR 277
Description: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants.

Anti-FANCM antibody

STJ190816 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FANCM

FANCM siRNA

20-abx916476
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FANCM siRNA

20-abx916477
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-FANCM

PVT12323 2 ug
EUR 391

anti-FANCM

YF-PA20264 50 ug
EUR 363
Description: Mouse polyclonal to FANCM

FANCM Blocking Peptide

DF9513-BP 1mg
EUR 195

FANCM cloning plasmid

CSB-CL810301HU-10ug 10ug
EUR 672
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2010
  • Sequence: atgagcggacggcaaagaacgctttttcagacgtggggctcaagtatctcccgatcatctgggactccgggttgcagctccggaactgagcgacctcagagccctggcagctccaaggcgcctttgccagcagcagcggaggctcagctggagtcggacgatgatgtgttgcttg
  • Show more
Description: A cloning plasmid for the FANCM gene.

Mouse FANCM shRNA Plasmid

20-abx979662
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FANCM ELISA KIT|Human

EF009560 96 Tests
EUR 689

Human FANCM shRNA Plasmid

20-abx961639
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Fanconi Anemia Complementation Group M (FANCM) Antibody

20-abx112462
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group M (FANCM) Antibody

abx146034-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group M (FANCM) Antibody

20-abx006242
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group M (FANCM) Antibody

20-abx321750
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group M (FANCM) Antibody

20-abx215299
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group M (FANCM) Antibody

abx432676-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Fanconi Anemia Complementation Group M (FANCM) Antibody

abx233012-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

FANCM ORF Vector (Human) (pORF)

ORF003921 1.0 ug DNA
EUR 95

Fancm ORF Vector (Mouse) (pORF)

ORF044581 1.0 ug DNA
EUR 2204

FANCM sgRNA CRISPR Lentivector set (Human)

K0757401 3 x 1.0 ug
EUR 339

Fancm sgRNA CRISPR Lentivector set (Mouse)

K4548801 3 x 1.0 ug
EUR 339

FANCM sgRNA CRISPR Lentivector (Human) (Target 1)

K0757402 1.0 ug DNA
EUR 154

FANCM sgRNA CRISPR Lentivector (Human) (Target 2)

K0757403 1.0 ug DNA
EUR 154

FANCM sgRNA CRISPR Lentivector (Human) (Target 3)

K0757404 1.0 ug DNA
EUR 154

Fancm sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4548802 1.0 ug DNA
EUR 154

Fancm sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4548803 1.0 ug DNA
EUR 154

Fancm sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4548804 1.0 ug DNA
EUR 154

FANCM Protein Vector (Mouse) (pPB-C-His)

PV178322 500 ng
EUR 3331

FANCM Protein Vector (Mouse) (pPB-N-His)

PV178323 500 ng
EUR 3331

FANCM Protein Vector (Mouse) (pPM-C-HA)

PV178324 500 ng
EUR 3331

FANCM Protein Vector (Mouse) (pPM-C-His)

PV178325 500 ng
EUR 3331

FANCM Protein Vector (Human) (pPB-C-His)

PV015681 500 ng
EUR 329

FANCM Protein Vector (Human) (pPB-N-His)

PV015682 500 ng
EUR 329

FANCM Protein Vector (Human) (pPM-C-HA)

PV015683 500 ng
EUR 329

FANCM Protein Vector (Human) (pPM-C-His)

PV015684 500 ng
EUR 329

Fancm 3'UTR GFP Stable Cell Line

TU156354 1.0 ml Ask for price

FANCM 3'UTR Luciferase Stable Cell Line

TU007709 1.0 ml
EUR 1394

Fancm 3'UTR Luciferase Stable Cell Line

TU106354 1.0 ml Ask for price

FANCM 3'UTR GFP Stable Cell Line

TU057709 1.0 ml
EUR 1394

Human Fanconi anemia group M protein, FANCM ELISA KIT

ELI-48578h 96 Tests
EUR 824

Human Fanconi Anemia Complementation Group M (FANCM) ELISA Kit

abx387299-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Fanconi Anemia Complementation Group M (FANCM) ELISA Kit

abx389244-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

FANCM Rabbit Polyclonal Antibody