FNBP4 Rabbit Polyclonal Antibody

FNBP4 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

FNBP4 Polyclonal Antibody

ABP58579-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FNBP4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FNBP4 from Human, Mouse. This FNBP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FNBP4 protein

FNBP4 Polyclonal Antibody

ABP58579-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FNBP4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FNBP4 from Human, Mouse. This FNBP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FNBP4 protein

FNBP4 Polyclonal Antibody

ABP58579-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FNBP4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FNBP4 from Human, Mouse. This FNBP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FNBP4 protein

FNBP4 Rabbit pAb

A13804-100ul 100 ul
EUR 308

FNBP4 Rabbit pAb

A13804-200ul 200 ul
EUR 459

FNBP4 Rabbit pAb

A13804-20ul 20 ul
EUR 183

FNBP4 Rabbit pAb

A13804-50ul 50 ul
EUR 223

FNBP4 Antibody

ABD9521 100 ug
EUR 438

FNBP4 Antibody

45983-100ul 100ul
EUR 252

FNBP4 Antibody

45983-50ul 50ul
EUR 187

FNBP4 Antibody

DF9521 200ul
EUR 304
Description: FNBP4 Antibody detects endogenous levels of total FNBP4.

FNBP4 Conjugated Antibody

C45983 100ul
EUR 397

Anti-FNBP4 antibody

STJ190822 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FNBP4

Anti-FNBP4 antibody

STJ115747 100 µl
EUR 277


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FNBP4 Blocking Peptide

DF9521-BP 1mg
EUR 195

FNBP4 cloning plasmid

CSB-CL822699HU-10ug 10ug
EUR 1094
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3048
  • Sequence: atggggaagaagtcccgggcggtacccggccgtaggcccatcctgcaactctctccgccgggtcctcggggcagcacgccgggccgggacccggagccggaacccgacactgagccggactcaaccgcggcggtccccagccagcccgccccgtcggcggcgacgaccaccgcgg
  • Show more
Description: A cloning plasmid for the FNBP4 gene.

Mouse FNBP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF005000 96 Tests
EUR 689

Human FNBP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Formin Binding Protein 4 (FNBP4) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

FNBP4 ORF Vector (Human) (pORF)

ORF004136 1.0 ug DNA
EUR 95

Fnbp4 ORF Vector (Rat) (pORF)

ORF067203 1.0 ug DNA
EUR 506

Fnbp4 ORF Vector (Mouse) (pORF)

ORF044976 1.0 ug DNA
EUR 506

FNBP4 sgRNA CRISPR Lentivector set (Human)

K0791501 3 x 1.0 ug
EUR 339

Fnbp4 sgRNA CRISPR Lentivector set (Mouse)

K4778001 3 x 1.0 ug
EUR 339

Fnbp4 sgRNA CRISPR Lentivector set (Rat)

K7363101 3 x 1.0 ug
EUR 339

FNBP4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0791502 1.0 ug DNA
EUR 154

FNBP4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0791503 1.0 ug DNA
EUR 154

FNBP4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0791504 1.0 ug DNA
EUR 154

Fnbp4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4778002 1.0 ug DNA
EUR 154

Fnbp4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4778003 1.0 ug DNA
EUR 154

Fnbp4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4778004 1.0 ug DNA
EUR 154

Fnbp4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7363102 1.0 ug DNA
EUR 154

Fnbp4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7363103 1.0 ug DNA
EUR 154

Fnbp4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7363104 1.0 ug DNA
EUR 154

FNBP4 Protein Vector (Rat) (pPB-C-His)

PV268810 500 ng
EUR 1191

FNBP4 Protein Vector (Rat) (pPB-N-His)

PV268811 500 ng
EUR 1191

FNBP4 Protein Vector (Rat) (pPM-C-HA)

PV268812 500 ng
EUR 1191

FNBP4 Protein Vector (Rat) (pPM-C-His)

PV268813 500 ng
EUR 1191

FNBP4 Protein Vector (Mouse) (pPB-C-His)

PV179902 500 ng
EUR 1065

FNBP4 Protein Vector (Mouse) (pPB-N-His)

PV179903 500 ng
EUR 1065

FNBP4 Protein Vector (Mouse) (pPM-C-HA)

PV179904 500 ng
EUR 1065

FNBP4 Protein Vector (Mouse) (pPM-C-His)

PV179905 500 ng
EUR 1065

FNBP4 Protein Vector (Human) (pPB-C-His)

PV016541 500 ng
EUR 329

FNBP4 Protein Vector (Human) (pPB-N-His)

PV016542 500 ng
EUR 329

FNBP4 Protein Vector (Human) (pPM-C-HA)

PV016543 500 ng
EUR 329

FNBP4 Protein Vector (Human) (pPM-C-His)

PV016544 500 ng
EUR 329

Fnbp4 3'UTR Luciferase Stable Cell Line

TU204710 1.0 ml Ask for price

Fnbp4 3'UTR GFP Stable Cell Line

TU156649 1.0 ml Ask for price

FNBP4 3'UTR Luciferase Stable Cell Line

TU008063 1.0 ml
EUR 1394

Fnbp4 3'UTR Luciferase Stable Cell Line

TU106649 1.0 ml Ask for price

FNBP4 3'UTR GFP Stable Cell Line

TU058063 1.0 ml
EUR 1394

Fnbp4 3'UTR GFP Stable Cell Line

TU254710 1.0 ml Ask for price

Human Formin- binding protein 4, FNBP4 ELISA KIT

ELI-27517h 96 Tests
EUR 824

Mouse Formin- binding protein 4, Fnbp4 ELISA KIT

ELI-32518m 96 Tests
EUR 865

Human Formin Binding Protein 4 (FNBP4) ELISA Kit

abx384921-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Formin Binding Protein 4 (FNBP4) ELISA Kit

abx389327-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

FNBP4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV634201 1.0 ug DNA
EUR 1355

FNBP4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV634205 1.0 ug DNA
EUR 1355

FNBP4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV634206 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

FNBP4 Rabbit Polyclonal Antibody