GAS2 Rabbit Polyclonal Antibody

GAS2 Rabbit Polyclonal Antibody

Order Now:

GAS2 Polyclonal Antibody

ABP58608-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GAS2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GAS2 from Human, Mouse. This GAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAS2 protein

GAS2 Polyclonal Antibody

ABP58608-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GAS2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GAS2 from Human, Mouse. This GAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAS2 protein

GAS2 Polyclonal Antibody

ES9683-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GAS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GAS2 Polyclonal Antibody

ES9683-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GAS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GAS2 Rabbit pAb

A1168-100ul 100 ul
EUR 308

GAS2 Rabbit pAb

A1168-200ul 200 ul
EUR 459

GAS2 Rabbit pAb

A1168-20ul 20 ul
EUR 183

GAS2 Rabbit pAb

A1168-50ul 50 ul
EUR 223

GAS2 antibody

70R-17426 50 ul
EUR 435
Description: Rabbit polyclonal GAS2 antibody

GAS2 Antibody

32198-100ul 100ul
EUR 252

GAS2 Antibody

DF6302 200ul
EUR 304
Description: GAS2 Antibody detects endogenous levels of total GAS2.

GAS2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GAS2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GAS2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GAS2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:1000-1:2000

GAS2 Antibody

ABD6302 100 ug
EUR 438

GAS2 Polyclonal Antibody, HRP Conjugated

A62631 100 µg
EUR 570.55
Description: reagents widely cited

GAS2 Polyclonal Antibody, FITC Conjugated

A62632 100 µg
EUR 570.55
Description: Ask the seller for details

GAS2 Polyclonal Antibody, Biotin Conjugated

A62633 100 µg
EUR 570.55
Description: The best epigenetics products

GAS2 Conjugated Antibody

C32198 100ul
EUR 397

anti- GAS2 antibody

FNab03350 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: growth arrest-specific 2
  • Uniprot ID: O43903
  • Gene ID: 2620
  • Research Area: Signal Transduction
Description: Antibody raised against GAS2

Anti-GAS2 antibody

PAab03350 100 ug
EUR 386

Anti-GAS2 antibody

STJ23749 100 µl
EUR 277
Description: The protein encoded by this gene is a caspase-3 substrate that plays a role in regulating microfilament and cell shape changes during apoptosis. It can also modulate cell susceptibility to p53-dependent apoptosis by inhibiting calpain activity. Alternative splicing results in multiple transcript variants.

Anti-GAS2 antibody

STJ190841 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GAS2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11945 50 ug
EUR 363
Description: Mouse polyclonal to GAS2


YF-PA11946 100 ug
EUR 403
Description: Rabbit polyclonal to GAS2


YF-PA23761 50 ul
EUR 334
Description: Mouse polyclonal to GAS2

GAS2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GAS2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GAS2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GAS2 Blocking Peptide

DF6302-BP 1mg
EUR 195

GAS2 cloning plasmid

CSB-CL009265HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atgtgcactgctctgagcccaaaggtacgcagtgggcctggcctctctgatatgcatcagtatagccaatggctagccagcagacatgaagctaatttgctaccaatgaaagaagatctggccttgtggttaaccaatctattagggaaggagattacagcagaaacttttatgga
  • Show more
Description: A cloning plasmid for the GAS2 gene.

anti-GAS2 (4E11)

LF-MA10116 100 ug
EUR 363
Description: Mouse monoclonal to GAS2


EF009782 96 Tests
EUR 689

Mouse GAS2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GAS2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GAS2 Recombinant Protein (Human)

RP012922 100 ug Ask for price

GAS2 Recombinant Protein (Rat)

RP202253 100 ug Ask for price

GAS2 Recombinant Protein (Mouse)

RP135935 100 ug Ask for price

GAS2-Like Protein 1 (GAS2L1) Antibody

abx025646-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GAS2-Like Protein 1 (GAS2L1) Antibody

abx025646-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GAS2-Like Protein 1 (GAS2L1) Antibody

abx117225-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

GAS2-Like Protein 1 (GAS2L1) Antibody

abx038082-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GAS2-Like Protein 1 (GAS2L1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GAS2-Like Protein 1 (GAS2L1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GAS2-Like Protein 1 (GAS2L1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat)

  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAS2 (Gly64~Asp267)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2)

Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), APC

  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAS2 (Gly64~Asp267)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with APC.

Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAS2 (Gly64~Asp267)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with Biotin.

Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAS2 (Gly64~Asp267)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with Cy3.

Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), FITC

  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAS2 (Gly64~Asp267)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with FITC.

Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), HRP

  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAS2 (Gly64~Asp267)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with HRP.

Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), PE

  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAS2 (Gly64~Asp267)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with PE.

Growth Arrest Specific Protein 2 (GAS2) Antibody

abx215555-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody

abx030639-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody

abx030639-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody

abx233350-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal GAS2 Antibody (monoclonal) (M01), Clone: 4E12

AMM03570G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GAS2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4E12. This antibody is applicable in WB and IF, E

Growth Arrest Specific Protein 2 (GAS2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gas2 ORF Vector (Rat) (pORF)

ORF067419 1.0 ug DNA
EUR 506

GAS2 ORF Vector (Human) (pORF)

ORF004308 1.0 ug DNA
EUR 95

Gas2 ORF Vector (Mouse) (pORF)

ORF045313 1.0 ug DNA
EUR 506

Recombinant Saccharomyces Cerevisiae GAS2 Protein

VAng-Wyb4670-inquire inquire Ask for price
Description: Saccharomyces Cerevisiae Growth Arrest-Specific 2 protein, recombinant protein.

Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 526.00
  • EUR 5782.00
  • EUR 1543.00
  • EUR 695.00
  • EUR 299.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAS2 (Gly64~Asp267)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with APC-Cy7.

Growth Arrest Specific Protein 2 (GAS2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Arrest Specific Protein 2 (GAS2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gas2 sgRNA CRISPR Lentivector set (Rat)

K6435101 3 x 1.0 ug
EUR 339

Gas2 sgRNA CRISPR Lentivector set (Mouse)

K3655001 3 x 1.0 ug
EUR 339

GAS2 sgRNA CRISPR Lentivector set (Human)

K0841401 3 x 1.0 ug
EUR 339

Recombinant human GAS2-like protein 3

P2394 100ug Ask for price
  • Uniprot ID: Q86XJ1
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GAS2-like protein 3

Gas2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6435102 1.0 ug DNA
EUR 154

Gas2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6435103 1.0 ug DNA
EUR 154

Gas2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6435104 1.0 ug DNA
EUR 154

Gas2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3655002 1.0 ug DNA
EUR 154

Gas2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3655003 1.0 ug DNA
EUR 154

Gas2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3655004 1.0 ug DNA
EUR 154

GAS2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0841402 1.0 ug DNA
EUR 154

GAS2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0841403 1.0 ug DNA
EUR 154

GAS2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0841404 1.0 ug DNA
EUR 154

GAS2 Protein Vector (Rat) (pPB-C-His)

PV269674 500 ng
EUR 603

GAS2 Protein Vector (Rat) (pPB-N-His)

PV269675 500 ng
EUR 603

GAS2 Protein Vector (Rat) (pPM-C-HA)

PV269676 500 ng
EUR 603

GAS2 Protein Vector (Rat) (pPM-C-His)

PV269677 500 ng
EUR 603

GAS2 Protein Vector (Mouse) (pPB-C-His)

PV181250 500 ng
EUR 603

GAS2 Protein Vector (Mouse) (pPB-N-His)

PV181251 500 ng
EUR 603

GAS2 Protein Vector (Mouse) (pPM-C-HA)

PV181252 500 ng
EUR 603

GAS2 Protein Vector (Mouse) (pPM-C-His)

PV181253 500 ng
EUR 603

GAS2 Protein Vector (Human) (pPB-C-His)

PV017229 500 ng
EUR 329

GAS2 Protein Vector (Human) (pPB-N-His)

PV017230 500 ng
EUR 329

GAS2 Protein Vector (Human) (pPM-C-HA)

PV017231 500 ng
EUR 329

GAS2 Protein Vector (Human) (pPM-C-His)

PV017232 500 ng
EUR 329

Recombinant Growth Arrest Specific Protein 2 (GAS2)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43903
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.5kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Growth Arrest Specific Protein 2 expressed in: E.coli

Gas2 3'UTR Luciferase Stable Cell Line

TU106916 1.0 ml Ask for price

Gas2 3'UTR GFP Stable Cell Line

TU156916 1.0 ml Ask for price

Gas2 3'UTR Luciferase Stable Cell Line

TU204958 1.0 ml Ask for price

Gas2 3'UTR GFP Stable Cell Line

TU254958 1.0 ml Ask for price

GAS2 3'UTR GFP Stable Cell Line

TU058621 1.0 ml
EUR 1394

GAS2 3'UTR Luciferase Stable Cell Line

TU008621 1.0 ml
EUR 1394

Human Growth Arrest Specific Protein 2 (GAS2) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse GAS2- like protein 1, Gas2l1 ELISA KIT

ELI-26628m 96 Tests
EUR 865

Mouse GAS2- like protein 2, Gas2l2 ELISA KIT

ELI-27166m 96 Tests
EUR 865

Mouse GAS2- like protein 3, Gas2l3 ELISA KIT

ELI-07822m 96 Tests
EUR 865

Human GAS2- like protein 2, GAS2L2 ELISA KIT

ELI-07926h 96 Tests
EUR 824

Human GAS2- like protein 3, GAS2L3 ELISA KIT

ELI-43348h 96 Tests
EUR 824

Human GAS2- like protein 1, GAS2L1 ELISA KIT

ELI-48415h 96 Tests
EUR 824

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

GAS2 Rabbit Polyclonal Antibody