MTFR1 Rabbit Polyclonal Antibody

MTFR1 Rabbit Polyclonal Antibody

Order Now:

MTFR1 Polyclonal Antibody

ABP59335-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MTFR1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of MTFR1 from Human, Mouse, Rat. This MTFR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MTFR1 protein at amino acid sequence of 160-240

MTFR1 Polyclonal Antibody

ABP59335-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MTFR1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of MTFR1 from Human, Mouse, Rat. This MTFR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MTFR1 protein at amino acid sequence of 160-240

MTFR1 Polyclonal Antibody

ABP59335-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MTFR1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of MTFR1 from Human, Mouse, Rat. This MTFR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MTFR1 protein at amino acid sequence of 160-240

MTFR1 Antibody

36624-100ul 100ul
EUR 252

MTFR1 antibody

70R-18659 50 ul
EUR 435
Description: Rabbit polyclonal MTFR1 antibody

MTFR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MTFR1. Recognizes MTFR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

MTFR1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MTFR1. Recognizes MTFR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

MTFR1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MTFR1. Recognizes MTFR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MTFR1 Conjugated Antibody

C36624 100ul
EUR 397

anti- MTFR1 antibody

FNab05398 100µg
EUR 505.25
  • Immunogen: mitochondrial fission regulator 1
  • Uniprot ID: Q15390
  • Gene ID: 9650
  • Research Area: Metabolism, Cancer, Cell Division and Proliferation
Description: Antibody raised against MTFR1

Anti-MTFR1 antibody

PAab05398 100 ug
EUR 355

Anti-MTFR1 antibody

STJ190967 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MTFR1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA16459 50 ug
EUR 363
Description: Mouse polyclonal to MTFR1

MTFR1 cloning plasmid

CSB-CL015151HU1-10ug 10ug
EUR 390
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgcttggctggattaagcgcctaattaggatggtttttcaacaagttggagtaagcatgcaatcggtactttggtctaggaagccatatggttcgtctcgaagtatcgtaaggaaaattggtactaatttgtctctgattcagtgtccaagagttcagtttcagattaacagcc
  • Show more
Description: A cloning plasmid for the MTFR1 gene.

MTFR1 cloning plasmid

CSB-CL015151HU2-10ug 10ug
EUR 390
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgcttggctggattaagcgcctaattaggatggtttttcaacaagttggagtaagcatgcaatcggtactttggtctaggaagccatatggttcgtctcgaagtatcgtaaggaaaattggtactaatttgtctctgattcagtgtccaagagttcagtttcagattaacagcc
  • Show more
Description: A cloning plasmid for the MTFR1 gene.

Mouse MTFR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MTFR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF000975 96 Tests
EUR 689

Human MTFR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MTFR1 Recombinant Protein (Human)

RP020275 100 ug Ask for price

MTFR1 Rabbit Polyclonal Antibody