MUC15 Rabbit Polyclonal Antibody

MUC15 Rabbit Polyclonal Antibody

Order Now:

MUC15 Polyclonal Antibody

ABP59340-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MUC15 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of MUC15 from Human, Mouse. This MUC15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC15 protein at amino acid sequence of 180-260

MUC15 Polyclonal Antibody

ABP59340-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MUC15 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of MUC15 from Human, Mouse. This MUC15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC15 protein at amino acid sequence of 180-260

MUC15 Polyclonal Antibody

ABP59340-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MUC15 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of MUC15 from Human, Mouse. This MUC15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC15 protein at amino acid sequence of 180-260

MUC15 antibody

70R-6736 50 ug
EUR 467
Description: Rabbit polyclonal MUC15 antibody raised against the middle region of MUC15

MUC15 Antibody

35635-100ul 100ul
EUR 252

MUC15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC15. Recognizes MUC15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

MUC15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC15. Recognizes MUC15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Polyclonal MUC15 Antibody (C-term)

APR03766G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUC15 (C-term). This antibody is tested and proven to work in the following applications:

MUC15 Conjugated Antibody

C35635 100ul
EUR 397

Anti-MUC15 antibody

STJ190982 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MUC15


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MUC15 Blocking Peptide

33R-4381 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MUC15 antibody, catalog no. 70R-6736

MUC15 cloning plasmid

CSB-CL822695HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1005
  • Sequence: atgttggccttagccaaaattctgttgatttcaacgttgttttattcacttctatcggggagccatggaaaagaaaatcaagacataaacacaacacagaacattgcagaagtttttaaaacaatggaaaataaacctatttctttggaaagtgaagcaaacttaaactcagata
  • Show more
Description: A cloning plasmid for the MUC15 gene.

Mouse MUC15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MUC15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MUC15 ELISA Kit

ELA-E1074h 96 Tests
EUR 824


EF002736 96 Tests
EUR 689

MUC15 Recombinant Protein (Human)

RP020383 100 ug Ask for price

MUC15 Recombinant Protein (Rat)

RP212771 100 ug Ask for price

MUC15 Recombinant Protein (Mouse)

RP152234 100 ug Ask for price

Mucin-15, Cell Surface Associated (MUC15) Antibody

abx027159-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mucin-15, Cell Surface Associated (MUC15) Antibody

abx027159-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mucin-15, Cell Surface Associated (MUC15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mucin-15, Cell Surface Associated (MUC15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MUC15 ORF Vector (Human) (pORF)

ORF006795 1.0 ug DNA
EUR 95

Muc15 ORF Vector (Mouse) (pORF)

ORF050746 1.0 ug DNA
EUR 506

Muc15 ORF Vector (Rat) (pORF)

ORF070925 1.0 ug DNA
EUR 506

MUC15 ELISA Kit (Human) (OKEH04436)

OKEH04436 96 Wells
EUR 662
Description: Description of target: May play a role in the cell adhesion to the extracellular matrix.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

MUC15 ELISA Kit (Mouse) (OKEH05708)

OKEH05708 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Human MUC15/ Mucin-15 ELISA Kit

E1666Hu 1 Kit
EUR 571

Human MUC15(Mucin-15) ELISA Kit

EH1209 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q8N387
  • Alias: MUC15/Mucin-15/MUC-15
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Mucin- 15, Muc15 ELISA KIT

ELI-03498m 96 Tests
EUR 865

Human Mucin- 15, MUC15 ELISA KIT

ELI-03499h 96 Tests
EUR 824

Bovine Mucin- 15, MUC15 ELISA KIT

ELI-03500b 96 Tests
EUR 928

Muc15 sgRNA CRISPR Lentivector set (Mouse)

K3702001 3 x 1.0 ug
EUR 339

Muc15 sgRNA CRISPR Lentivector set (Rat)

K6330001 3 x 1.0 ug
EUR 339

Human Mucin-15(MUC15) ELISA kit

CSB-EL015218HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-15 (MUC15) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

MUC15 Rabbit Polyclonal Antibody