NEIL2 Rabbit Polyclonal Antibody

NEIL2 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

NEIL2 Polyclonal Antibody

ABP59439-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NEIL2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NEIL2 from Human, Mouse. This NEIL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEIL2 protein

NEIL2 Antibody

ABD9499 100 ug
EUR 438

NEIL2 Antibody

45969-100ul 100ul
EUR 252

NEIL2 Antibody

45969-50ul 50ul
EUR 187

NEIL2 antibody

10R-1554 100 ug
EUR 512
Description: Mouse monoclonal NEIL2 antibody

NEIL2 Antibody

DF9499 200ul
EUR 304
Description: NEIL2 Antibody detects endogenous levels of total NEIL2.

NEIL2 Conjugated Antibody

C45969 100ul
EUR 397

Anti-NEIL2 antibody

STJ190804 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NEIL2

NEIL2 siRNA

20-abx925704
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEIL2 siRNA

20-abx925705
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NEIL2

YF-PA22799 50 ul
EUR 363
Description: Mouse polyclonal to NEIL2

anti-NEIL2

YF-PA22800 100 ul
EUR 403
Description: Rabbit polyclonal to NEIL2

anti-NEIL2

YF-PA22801 100 ug
EUR 403
Description: Rabbit polyclonal to NEIL2

NEIL2 Blocking Peptide

20-abx161176
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NEIL2 Blocking Peptide

DF9499-BP 1mg
EUR 195

NEIL2 cloning plasmid

CSB-CL846576HU-10ug 10ug
EUR 390
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 999
  • Sequence: atgccagaagggccgttggtgaggaaatttcaccatttggtctccccctttgtgggtcagcaggtggtcaagacagggggcagcagtaagaagctacagcccgccagcctgcagtctctgtggctccaggacacccaggtccatggaaagaaattattccttagatttgatctaga
  • Show more
Description: A cloning plasmid for the NEIL2 gene.

Anti-NEIL2 (1B7)

YF-MA20059 100 ug
EUR 363
Description: Mouse monoclonal to NEIL2

Mouse NEIL2 shRNA Plasmid

20-abx983907
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEIL2 protein (His tag)

80R-2266 50 ug
EUR 424
Description: Purified recombinant Human NEIL2 Protein (His tag)

Human NEIL2 shRNA Plasmid

20-abx966629
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEIL2 Recombinant Protein (Human)

RP021055 100 ug Ask for price

NEIL2 Recombinant Protein (Rat)

RP213653 100 ug Ask for price

NEIL2 Recombinant Protein (Mouse)

RP153632 100 ug Ask for price

Endonuclease 8-Like 2 (NEIL2) Antibody

20-abx121176
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Endonuclease 8-Like 2 (NEIL2) Antibody

abx028552-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Endonuclease 8-Like 2 (NEIL2) Antibody

abx028552-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Endonuclease 8-Like 2 (NEIL2) Antibody

20-abx217106
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NEIL2 ORF Vector (Human) (pORF)

ORF007019 1.0 ug DNA
EUR 95

Neil2 ORF Vector (Rat) (pORF)

ORF071219 1.0 ug DNA
EUR 506

Neil2 ORF Vector (Mouse) (pORF)

ORF051212 1.0 ug DNA
EUR 506

NEIL2 sgRNA CRISPR Lentivector set (Human)

K1416001 3 x 1.0 ug
EUR 339

Neil2 sgRNA CRISPR Lentivector set (Mouse)

K3567601 3 x 1.0 ug
EUR 339

Neil2 sgRNA CRISPR Lentivector set (Rat)

K7616601 3 x 1.0 ug
EUR 339

NEIL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1416002 1.0 ug DNA
EUR 154

NEIL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1416003 1.0 ug DNA
EUR 154

NEIL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1416004 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3567602 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3567603 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3567604 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7616602 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7616603 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7616604 1.0 ug DNA
EUR 154

Recombinant Human NEIL2 Protein, His, E.coli-10ug

QP12826-10ug 10ug
EUR 201

Recombinant Human NEIL2 Protein, His, E.coli-1mg

QP12826-1mg 1mg
EUR 5251

Recombinant Human NEIL2 Protein, His, E.coli-2ug

QP12826-2ug 2ug
EUR 155

NEIL2 Protein Vector (Rat) (pPB-C-His)

PV284874 500 ng
EUR 603

NEIL2 Protein Vector (Rat) (pPB-N-His)

PV284875 500 ng
EUR 603

NEIL2 Protein Vector (Rat) (pPM-C-HA)

PV284876 500 ng
EUR 603

NEIL2 Protein Vector (Rat) (pPM-C-His)

PV284877 500 ng
EUR 603

NEIL2 Protein Vector (Human) (pPB-C-His)

PV028073 500 ng
EUR 329

NEIL2 Protein Vector (Human) (pPB-N-His)

PV028074 500 ng
EUR 329

NEIL2 Protein Vector (Human) (pPM-C-HA)

PV028075 500 ng
EUR 329

NEIL2 Protein Vector (Human) (pPM-C-His)

PV028076 500 ng
EUR 329

NEIL2 Protein Vector (Mouse) (pPB-C-His)

PV204846 500 ng
EUR 603

NEIL2 Protein Vector (Mouse) (pPB-N-His)

PV204847 500 ng
EUR 603

NEIL2 Protein Vector (Mouse) (pPM-C-HA)

PV204848 500 ng
EUR 603

NEIL2 Protein Vector (Mouse) (pPM-C-His)

PV204849 500 ng
EUR 603

Neil2 3'UTR GFP Stable Cell Line

TU163981 1.0 ml Ask for price

Neil2 3'UTR Luciferase Stable Cell Line

TU213879 1.0 ml Ask for price

NEIL2 3'UTR Luciferase Stable Cell Line

TU015563 1.0 ml
EUR 1394

Neil2 3'UTR Luciferase Stable Cell Line

TU113981 1.0 ml Ask for price

NEIL2 3'UTR GFP Stable Cell Line

TU065563 1.0 ml
EUR 1394

Neil2 3'UTR GFP Stable Cell Line

TU263879 1.0 ml Ask for price

Bovine Endonuclease 8- like 2, NEIL2 ELISA KIT

ELI-13798b 96 Tests
EUR 928

Mouse Endonuclease 8- like 2, Neil2 ELISA KIT

ELI-13799m 96 Tests
EUR 865

Human Endonuclease 8- like 2, NEIL2 ELISA KIT

ELI-42479h 96 Tests
EUR 824

NEIL2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV640309 1.0 ug DNA
EUR 514

NEIL2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV640313 1.0 ug DNA
EUR 514

NEIL2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV640314 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NEIL2 Rabbit Polyclonal Antibody