PDS5B Rabbit Polyclonal Antibody

PDS5B Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

PDS5B Polyclonal Antibody

ES9388-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PDS5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDS5B Rabbit pAb

A19504-100ul 100 ul Ask for price

PDS5B Rabbit pAb

A19504-200ul 200 ul Ask for price

PDS5B Rabbit pAb

A19504-20ul 20 ul Ask for price

PDS5B Rabbit pAb

A19504-50ul 50 ul
EUR 308

PDS5B antibody

70R-19197 50 ul
EUR 435
Description: Rabbit polyclonal PDS5B antibody

PDS5B antibody

70R-2864 50 ug
EUR 467
Description: Rabbit polyclonal PDS5B antibody

PDS5B Antibody

36260-100ul 100ul
EUR 252

PDS5B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA

PDS5B Antibody

DF9206 200ul
EUR 304
Description: PDS5B Antibody detects endogenous levels of total PDS5B.

PDS5B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PDS5B Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PDS5B Antibody

ABD9206 100 ug
EUR 438

Polyclonal PDS5B Antibody (C-Term)

APR04963G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDS5B (C-Term). This antibody is tested and proven to work in the following applications:

PDS5B Conjugated Antibody

C36260 100ul
EUR 397

anti- PDS5B antibody

FNab06291 100µg
EUR 548.75
  • Immunogen: PDS5, regulator of cohesion maintenance, homolog B(S. cerevisiae)
  • Uniprot ID: Q9NTI5
  • Gene ID: 23047
  • Research Area: Cell Division and Proliferation, Developmental biology
Description: Antibody raised against PDS5B

Anti-PDS5B antibody

PAab06291 100 ug
EUR 386

Anti-PDS5B antibody

STJ11100697 50 µl
EUR 287
Description: This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene.

Anti-PDS5B antibody

STJ190546 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PDS5B

Pds5b/ Rat Pds5b ELISA Kit

ELI-16115r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PDS5B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PDS5B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PDS5B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PDS5B Blocking Peptide

33R-1917 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDS5B antibody, catalog no. 70R-2864

PDS5B Blocking Peptide

DF9206-BP 1mg
EUR 195

PDS5B cloning plasmid

CSB-CL889108HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1590
  • Sequence: atggctcattcaaagactaggaccaatgatggaaaaattacatatccgcctggggtcaaggaaatatcagataaaatatctaaagaggagatggtgagacgattaaagatggttgtgaaaacttttatggatatggaccaggactctgaagaagaaaaggagctttatttaaacc
  • Show more
Description: A cloning plasmid for the PDS5B gene.

PDS5B cloning plasmid

CSB-CL889108HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atggctcattcaaagactaggaccaatgatggaaaaattacatatccgcctggggtcaaggaaatatcagataaaatatctaaagaggagatggtgagacgattaaagatggttgtgaaaacttttatggatatggaccaggactctgaagaagaaaaggagctttatttaaacct
  • Show more
Description: A cloning plasmid for the PDS5B gene.


ELI-20934h 96 Tests
EUR 824


EF001663 96 Tests
EUR 689

Mouse Pds5b ELISA KIT

ELI-45060m 96 Tests
EUR 865

Human PDS5B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PDS5B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-37729c 96 Tests
EUR 928

PDS5 Cohesin Associated Factor B (PDS5B) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

PDS5 Cohesin Associated Factor B (Pds5b) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

PDS5 Cohesin Associated Factor B (PDS5B) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

PDS5 Cohesin Associated Factor B (PDS5B) Antibody

abx340056-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

PDS5 Cohesin Associated Factor B (PDS5B) Antibody

abx236291-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

PDS5 Cohesin Associated Factor B (PDS5B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pds5b ORF Vector (Rat) (pORF)

ORF073316 1.0 ug DNA
EUR 2080

Pds5b ORF Vector (Rat) (pORF)

ORF073317 1.0 ug DNA
EUR 2080

PDS5B ORF Vector (Human) (pORF)

ORF007667 1.0 ug DNA
EUR 95

PDS5B ORF Vector (Human) (pORF)

ORF007668 1.0 ug DNA
EUR 95

Pds5b ORF Vector (Mouse) (pORF)

ORF053728 1.0 ug DNA
EUR 1572

PDS5 Cohesin Associated Factor B (PDS5B) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PDS5 Cohesin Associated Factor B (PDS5B) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PDS5 Cohesin Associated Factor B (PDS5B) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) ELISA kit

E04S0341-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) ELISA kit

E04S0341-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) ELISA kit

E04S0341-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pds5b sgRNA CRISPR Lentivector set (Mouse)

K4979001 3 x 1.0 ug
EUR 339

Pds5b sgRNA CRISPR Lentivector set (Rat)

K7346801 3 x 1.0 ug
EUR 339

PDS5B sgRNA CRISPR Lentivector set (Human)

K1623601 3 x 1.0 ug
EUR 339

Pds5b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4979002 1.0 ug DNA
EUR 154

Pds5b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4979003 1.0 ug DNA
EUR 154

Pds5b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4979004 1.0 ug DNA
EUR 154

Pds5b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7346802 1.0 ug DNA
EUR 154

Pds5b sgRNA CRISPR Lentivector (Rat) (Target 2)

K7346803 1.0 ug DNA
EUR 154

Pds5b sgRNA CRISPR Lentivector (Rat) (Target 3)

K7346804 1.0 ug DNA
EUR 154

PDS5B sgRNA CRISPR Lentivector (Human) (Target 1)

K1623602 1.0 ug DNA
EUR 154

PDS5B sgRNA CRISPR Lentivector (Human) (Target 2)

K1623603 1.0 ug DNA
EUR 154

PDS5B sgRNA CRISPR Lentivector (Human) (Target 3)

K1623604 1.0 ug DNA
EUR 154

PDS5B Protein Vector (Rat) (pPB-C-His)

PV293262 500 ng
EUR 2462

PDS5B Protein Vector (Rat) (pPB-N-His)

PV293263 500 ng
EUR 2462

PDS5B Protein Vector (Rat) (pPM-C-HA)

PV293264 500 ng
EUR 2462

PDS5B Protein Vector (Rat) (pPM-C-His)

PV293265 500 ng
EUR 2462

PDS5B Protein Vector (Rat) (pPB-C-His)

PV293266 500 ng
EUR 2405

PDS5B Protein Vector (Rat) (pPB-N-His)

PV293267 500 ng
EUR 2405

PDS5B Rabbit Polyclonal Antibody