PJA1 Rabbit Polyclonal Antibody

PJA1 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

PJA1 Polyclonal Antibody

ABP59920-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PJA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PJA1 from Human. This PJA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PJA1 protein

PJA1 Polyclonal Antibody

ABP59920-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PJA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PJA1 from Human. This PJA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PJA1 protein

PJA1 Polyclonal Antibody

ES9632-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PJA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PJA1 Polyclonal Antibody

ES9632-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PJA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PJA1 antibody

70R-19311 50 ul
EUR 435
Description: Rabbit polyclonal PJA1 antibody

PJA1 Antibody

45961-100ul 100ul
EUR 252

PJA1 Antibody

45961-50ul 50ul
EUR 187

PJA1 Antibody

DF9487 200ul
EUR 304
Description: PJA1 Antibody detects endogenous levels of total PJA1.

PJA1 Antibody

1-CSB-PA018049GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PJA1. Recognizes PJA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PJA1 Antibody

ABD9487 100 ug
EUR 438

PJA1 Conjugated Antibody

C45961 100ul
EUR 397

anti- PJA1 antibody

FNab06477 100µg
EUR 505.25
  • Immunogen: praja ring finger 1
  • Uniprot ID: Q8NG27
  • Gene ID: 64219
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against PJA1

Anti-PJA1 antibody

PAab06477 100 ug
EUR 355

Anti-PJA1 antibody

STJ190790 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PJA1

PJA1 siRNA

20-abx928710
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PJA1 siRNA

20-abx928711
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PJA1 Blocking Peptide

DF9487-BP 1mg
EUR 195

PJA1 cloning plasmid

CSB-CL844051HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1932
  • Sequence: atgggtcaggaatctagcaagcctgtatggcccaatccaacaggagggtatcagtccaatacaggtaggaggtatggaagaaggcatgcttatgtcagtttcaggccacccacgagccagcgggaaaggattgccagccagagaaagacgaactccgaagtcccaatgcacagat
  • Show more
Description: A cloning plasmid for the PJA1 gene.

PJA1 ELISA KIT|Human

EF001813 96 Tests
EUR 689

Mouse PJA1 shRNA Plasmid

20-abx972053
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PJA1 shRNA Plasmid

20-abx961962
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PJA1 Recombinant Protein (Human)

RP023614 100 ug Ask for price

PJA1 Recombinant Protein (Mouse)

RP162350 100 ug Ask for price

PJA1 Recombinant Protein (Mouse)

RP162353 100 ug Ask for price

PJA1 ORF Vector (Human) (pORF)

ORF007872 1.0 ug DNA
EUR 95

Pja1 ORF Vector (Mouse) (pORF)

ORF054118 1.0 ug DNA
EUR 506

Pja1 ORF Vector (Mouse) (pORF)

ORF054119 1.0 ug DNA
EUR 506

E3 Ubiquitin-Protein Ligase Praja-1 (PJA1) Antibody

20-abx218331
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase Praja-1 (PJA1) Antibody

abx236477-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Pja1 sgRNA CRISPR Lentivector set (Mouse)

K3918101 3 x 1.0 ug
EUR 339

PJA1 sgRNA CRISPR Lentivector set (Human)

K1654901 3 x 1.0 ug
EUR 339

Pja1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3918102 1.0 ug DNA
EUR 154

Pja1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3918103 1.0 ug DNA
EUR 154

Pja1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3918104 1.0 ug DNA
EUR 154

PJA1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1654902 1.0 ug DNA
EUR 154

PJA1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1654903 1.0 ug DNA
EUR 154

PJA1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1654904 1.0 ug DNA
EUR 154

PJA1 Protein Vector (Human) (pPB-C-His)

PV031485 500 ng
EUR 329

PJA1 Protein Vector (Human) (pPB-N-His)

PV031486 500 ng
EUR 329

PJA1 Protein Vector (Human) (pPM-C-HA)

PV031487 500 ng
EUR 329

PJA1 Protein Vector (Human) (pPM-C-His)

PV031488 500 ng
EUR 329

PJA1 Protein Vector (Mouse) (pPB-C-His)

PV216470 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPB-N-His)

PV216471 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPM-C-HA)

PV216472 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPM-C-His)

PV216473 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPB-C-His)

PV216474 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPB-N-His)

PV216475 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPM-C-HA)

PV216476 500 ng
EUR 603

PJA1 Protein Vector (Mouse) (pPM-C-His)

PV216477 500 ng
EUR 603

Pja1 3'UTR Luciferase Stable Cell Line

TU116430 1.0 ml Ask for price

Pja1 3'UTR GFP Stable Cell Line

TU166430 1.0 ml Ask for price

PJA1 3'UTR GFP Stable Cell Line

TU068128 1.0 ml
EUR 1394

PJA1 3'UTR Luciferase Stable Cell Line

TU018128 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

PJA1 Rabbit Polyclonal Antibody