RIT2 Rabbit Polyclonal Antibody

RIT2 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

RIT2 Polyclonal Antibody

ABP60182-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RIT2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIT2 from Human, Mouse, Rat. This RIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIT2 protein

RIT2 Polyclonal Antibody

ABP60182-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RIT2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIT2 from Human, Mouse, Rat. This RIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIT2 protein

RIT2 Polyclonal Antibody

ABP60182-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RIT2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIT2 from Human, Mouse, Rat. This RIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIT2 protein

RIT2 Polyclonal Antibody

A60614 100 µg
EUR 570.55
Description: reagents widely cited

RIT2 Polyclonal Antibody

27869-100ul 100ul
EUR 252

RIT2 Polyclonal Antibody

27869-50ul 50ul
EUR 187

RIT2 Rabbit pAb

A13043-100ul 100 ul
EUR 308

RIT2 Rabbit pAb

A13043-200ul 200 ul
EUR 459

RIT2 Rabbit pAb

A13043-20ul 20 ul
EUR 183

RIT2 Rabbit pAb

A13043-50ul 50 ul
EUR 223

RIT2 Polyclonal Conjugated Antibody

C27869 100ul
EUR 397

RIT2 antibody

10R-5625 100 ul
EUR 691
Description: Mouse monoclonal RIT2 antibody

RIT2 antibody

10R-5626 100 ul
EUR 691
Description: Mouse monoclonal RIT2 antibody

RIT2 Antibody

1-CSB-PA860769LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal RIT2 Antibody (N-term)

AMM08676G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIT2 (N-term). This antibody is tested and proven to work in the following applications:

RIT2 Polyclonal Antibody, Biotin Conjugated

A60615 100 µg
EUR 570.55
Description: Ask the seller for details

RIT2 Polyclonal Antibody, FITC Conjugated

A60616 100 µg
EUR 570.55
Description: The best epigenetics products

RIT2 Polyclonal Antibody, HRP Conjugated

A60617 100 µg
EUR 570.55
Description: kits suitable for this type of research

GTP-Binding Protein Rit2 (RIT2) Antibody

abx145163-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GTP-Binding Protein Rit2 (RIT2) Antibody

abx028897-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GTP-Binding Protein Rit2 (RIT2) Antibody

abx028897-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GTP-Binding Protein Rit2 (RIT2) Antibody

20-abx310582
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GTP-Binding Protein Rit2 (RIT2) Antibody (HRP)

20-abx310583
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GTP-Binding Protein Rit2 (RIT2) Antibody (FITC)

20-abx310584
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GTP-Binding Protein Rit2 (RIT2) Antibody (Biotin)

20-abx310585
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rit2/ Rat Rit2 ELISA Kit

ELI-30292r 96 Tests
EUR 886

Anti-RIT2 antibody

STJ115010 100 µl
EUR 277

Anti-RIT2 antibody

STJ190852 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RIT2

RIT2 siRNA

20-abx904587
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIT2 siRNA

20-abx931577
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIT2 siRNA

20-abx931578
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RIT2

YF-PA14393 50 ul
EUR 363
Description: Mouse polyclonal to RIT2

anti-RIT2

YF-PA14394 50 ug
EUR 363
Description: Mouse polyclonal to RIT2

RIT2 Antibody, HRP conjugated

1-CSB-PA860769LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIT2 Antibody, FITC conjugated

1-CSB-PA860769LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIT2 Antibody, Biotin conjugated

1-CSB-PA860769LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIT2. Recognizes RIT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GTP- binding protein Rit2, RIT2 ELISA KIT

ELI-52510h 96 Tests
EUR 824

Mouse GTP- binding protein Rit2, Rit2 ELISA KIT

ELI-35629m 96 Tests
EUR 865

RIT2 cloning plasmid

CSB-CL860769HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggaggtagaaaatgaagccagctgctccccgggcagcgcatcaggcgggtccagagagtacaaggtggtaatgctgggagcagggggagttggtaaaagcgcaatgacaatgcagtttattagtcatcagttccctgattatcatgaccctactatagaagatgcttataagac
  • Show more
Description: A cloning plasmid for the RIT2 gene.

pBluescriptR-RIT2 Plasmid

PVT17041 2 ug
EUR 325

Anti-RIT2 (3F2)

YF-MA15198 100 ug
EUR 363
Description: Mouse monoclonal to RIT2

Rat RIT2 shRNA Plasmid

20-abx988520
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RIT2 shRNA Plasmid

20-abx954080
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RIT2 shRNA Plasmid

20-abx972459
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rit2 Recombinant Protein (Human)

RP026488 100 ug Ask for price

Rit2 Recombinant Protein (Rat)

RP226187 100 ug Ask for price

Rit2 Recombinant Protein (Mouse)

RP168311 100 ug Ask for price

Monoclonal RIT2 Antibody (monoclonal) (M01), Clone: 3F2

AMM07621G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RIT2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F2. This antibody is applicable in WB, E

RIT2 ORF Vector (Human) (pORF)

ORF008830 1.0 ug DNA
EUR 95

Rit2 ORF Vector (Mouse) (pORF)

ORF056105 1.0 ug DNA
EUR 506

Rit2 ORF Vector (Rat) (pORF)

ORF075397 1.0 ug DNA
EUR 506

Monoclonal RIT2 / RIN Antibody (clone 27G2), Clone: 27G2

AMM07620G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human RIT2 / RIN (clone 27G2). The antibodies are raised in Mouse and are from clone 27G2. This antibody is applicable in WB and IHC-P

RIT2 sgRNA CRISPR Lentivector set (Human)

K1826501 3 x 1.0 ug
EUR 339

Rit2 sgRNA CRISPR Lentivector set (Rat)

K7427501 3 x 1.0 ug
EUR 339

Rit2 sgRNA CRISPR Lentivector set (Mouse)

K3399301 3 x 1.0 ug
EUR 339

RIT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1826502 1.0 ug DNA
EUR 154

RIT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1826503 1.0 ug DNA
EUR 154

RIT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1826504 1.0 ug DNA
EUR 154

Rit2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7427502 1.0 ug DNA
EUR 154

Rit2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7427503 1.0 ug DNA
EUR 154

Rit2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7427504 1.0 ug DNA
EUR 154

Rit2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3399302 1.0 ug DNA
EUR 154

Rit2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3399303 1.0 ug DNA
EUR 154

Rit2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3399304 1.0 ug DNA
EUR 154

Rit2 Protein Vector (Human) (pPB-C-His)

PV035317 500 ng
EUR 329

Rit2 Protein Vector (Human) (pPB-N-His)

PV035318 500 ng
EUR 329

Rit2 Protein Vector (Human) (pPM-C-HA)

PV035319 500 ng
EUR 329

Rit2 Protein Vector (Human) (pPM-C-His)

PV035320 500 ng
EUR 329

Rit2 Protein Vector (Rat) (pPB-C-His)

PV301586 500 ng
EUR 603

Rit2 Protein Vector (Rat) (pPB-N-His)

PV301587 500 ng
EUR 603

Rit2 Protein Vector (Rat) (pPM-C-HA)

PV301588 500 ng
EUR 603

Rit2 Protein Vector (Rat) (pPM-C-His)

PV301589 500 ng
EUR 603

Rit2 Protein Vector (Mouse) (pPB-C-His)

PV224418 500 ng
EUR 603

Rit2 Protein Vector (Mouse) (pPB-N-His)

PV224419 500 ng
EUR 603

Rit2 Protein Vector (Mouse) (pPM-C-HA)

PV224420 500 ng
EUR 603

Rit2 Protein Vector (Mouse) (pPM-C-His)

PV224421 500 ng
EUR 603

Rit2 3'UTR GFP Stable Cell Line

TU167911 1.0 ml Ask for price

RIT2 3'UTR Luciferase Stable Cell Line

TU019943 1.0 ml
EUR 1394

Rit2 3'UTR Luciferase Stable Cell Line

TU117911 1.0 ml Ask for price

RIT2 3'UTR GFP Stable Cell Line

TU069943 1.0 ml
EUR 1394

Rit2 3'UTR Luciferase Stable Cell Line

TU219463 1.0 ml Ask for price

Rit2 3'UTR GFP Stable Cell Line

TU269463 1.0 ml Ask for price

Rit2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV695077 1.0 ug DNA
EUR 514

Rit2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV695081 1.0 ug DNA
EUR 514

Rit2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV695082 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RIT2 Rabbit Polyclonal Antibody