RNF41 Rabbit Polyclonal Antibody

RNF41 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

RNF41 Polyclonal Antibody
ES9631-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RNF41 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RNF41 Polyclonal Antibody
ABP60220-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RNF41 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RNF41 from Human, Mouse. This RNF41 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF41 protein
RNF41 Polyclonal Antibody
ABP60220-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RNF41 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RNF41 from Human, Mouse. This RNF41 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF41 protein
RNF41 Polyclonal Antibody
ABP60220-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RNF41 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RNF41 from Human, Mouse. This RNF41 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RNF41 protein
RNF41 Antibody
ABD9486 100 ug
EUR 438
RNF41 Antibody
45960-100ul 100ul
EUR 252
RNF41 Antibody
45960-50ul 50ul
EUR 187
RNF41 Antibody
DF9486 200ul
EUR 304
Description: RNF41 Antibody detects endogenous levels of total RNF41.
RNF41 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RNF41. Recognizes RNF41 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
Polyclonal RNF41 Antibody (C-term)
APR04327G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RNF41 (C-term). This antibody is tested and proven to work in the following applications:
RNF41 Conjugated Antibody
C45960 100ul
EUR 397
anti- RNF41 antibody
FNab07359 100µg
EUR 548.75
  • Immunogen: ring finger protein 41
  • Uniprot ID: Q9H4P4
  • Gene ID: 10193
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against RNF41
Anti-RNF41 antibody
PAab07359 100 ug
EUR 386
Anti-RNF41 antibody
STJ190789 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RNF41
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA16776 50 ug
EUR 363
Description: Mouse polyclonal to RNF41
YF-PA16777 50 ug
EUR 363
Description: Mouse polyclonal to RNF41
YF-PA16778 100 ug
EUR 403
Description: Rabbit polyclonal to RNF41
YF-PA25503 50 ul
EUR 334
Description: Mouse polyclonal to RNF41
RNF41 cloning plasmid
CSB-CL880976HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 954
  • Sequence: atggggtatgatgtaacccgtttccagggggatgttgacgaagatcttatctgccctatttgcagtggagtcttggaggagccagtacaggcacctcattgtgaacatgctttctgcaacgcctgcatcacccagtggttctctcagcaacagacatgtccagtggaccgtagtgt
  • Show more
Description: A cloning plasmid for the RNF41 gene.
RNF41 Blocking Peptide
DF9486-BP 1mg
EUR 195
PVT14262 2 ug
EUR 599
Anti-RNF41 (4C2)
YF-MA17168 200 ul
EUR 363
Description: Mouse monoclonal to RNF41
Mouse RNF41 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RNF41 ELISA kit
ELI-18493h 96 Tests
EUR 824
EF002527 96 Tests
EUR 689
Mouse RNF41 ELISA kit
ELI-40878m 96 Tests
EUR 865
Human RNF41 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RNF41 Recombinant Protein (Human)
RP026692 100 ug Ask for price
RNF41 Recombinant Protein (Rat)
RP226451 100 ug Ask for price
RNF41 Recombinant Protein (Mouse)
RP168668 100 ug Ask for price
RNF41 Recombinant Protein (Mouse)
RP168671 100 ug Ask for price
Ring Finger Protein 41 (RNF41) Antibody
abx145584-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ring Finger Protein 41 (RNF41) Antibody
abx030397-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ring Finger Protein 41 (RNF41) Antibody
abx030397-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ring Finger Protein 41 (RNF41) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ring Finger Protein 41 (RNF41) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ring Finger Protein 41 (RNF41) Antibody
abx237359-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Monoclonal RNF41 Antibody (monoclonal) (M01A), Clone: 4C2
AMM04030G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human RNF41 (monoclonal) (M01A). The antibodies are raised in mouse and are from clone 4C2. This antibody is applicable in WB
RNF41 ORF Vector (Human) (pORF)
ORF008898 1.0 ug DNA
EUR 95
Rnf41 ORF Vector (Mouse) (pORF)
ORF056224 1.0 ug DNA
EUR 506
Rnf41 ORF Vector (Mouse) (pORF)
ORF056225 1.0 ug DNA
EUR 506
Rnf41 ORF Vector (Rat) (pORF)
ORF075485 1.0 ug DNA
EUR 506
PVT14274 2 ug
EUR 599
RNF41 sgRNA CRISPR Lentivector set (Human)
K1836401 3 x 1.0 ug
EUR 339
Rnf41 sgRNA CRISPR Lentivector set (Mouse)
K4828401 3 x 1.0 ug
EUR 339
Rnf41 sgRNA CRISPR Lentivector set (Rat)
K6550101 3 x 1.0 ug
EUR 339
RNF41 sgRNA CRISPR Lentivector (Human) (Target 1)
K1836402 1.0 ug DNA
EUR 154
RNF41 sgRNA CRISPR Lentivector (Human) (Target 2)
K1836403 1.0 ug DNA
EUR 154
RNF41 sgRNA CRISPR Lentivector (Human) (Target 3)
K1836404 1.0 ug DNA
EUR 154
Human E3 ubiquitin-protein ligase NRDP1 (RNF41)
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase NRDP1(RNF41) expressed in E.coli
Rnf41 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4828402 1.0 ug DNA
EUR 154
Rnf41 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4828403 1.0 ug DNA
EUR 154
Rnf41 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4828404 1.0 ug DNA
EUR 154
Rnf41 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6550102 1.0 ug DNA
EUR 154
Rnf41 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6550103 1.0 ug DNA
EUR 154
Rnf41 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6550104 1.0 ug DNA
EUR 154
RNF41 Protein Vector (Human) (pPB-C-His)
PV035589 500 ng
EUR 329
RNF41 Protein Vector (Human) (pPB-N-His)
PV035590 500 ng
EUR 329
RNF41 Protein Vector (Human) (pPM-C-HA)
PV035591 500 ng
EUR 329
RNF41 Protein Vector (Human) (pPM-C-His)
PV035592 500 ng
EUR 329
RNF41 Protein Vector (Rat) (pPB-C-His)
PV301938 500 ng
EUR 603
RNF41 Protein Vector (Rat) (pPB-N-His)
PV301939 500 ng
EUR 603
RNF41 Protein Vector (Rat) (pPM-C-HA)
PV301940 500 ng
EUR 603
RNF41 Protein Vector (Rat) (pPM-C-His)
PV301941 500 ng
EUR 603
RNF41 Protein Vector (Mouse) (pPB-C-His)
PV224894 500 ng
EUR 603
RNF41 Protein Vector (Mouse) (pPB-N-His)
PV224895 500 ng
EUR 603
RNF41 Protein Vector (Mouse) (pPM-C-HA)
PV224896 500 ng
EUR 603
RNF41 Protein Vector (Mouse) (pPM-C-His)
PV224897 500 ng
EUR 603
RNF41 Protein Vector (Mouse) (pPB-C-His)
PV224898 500 ng
EUR 603
RNF41 Protein Vector (Mouse) (pPB-N-His)
PV224899 500 ng
EUR 603
RNF41 Protein Vector (Mouse) (pPM-C-HA)
PV224900 500 ng
EUR 603
RNF41 Protein Vector (Mouse) (pPM-C-His)
PV224901 500 ng
EUR 603
Rnf41 3'UTR GFP Stable Cell Line
TU168012 1.0 ml Ask for price
RNF41 3'UTR Luciferase Stable Cell Line
TU020048 1.0 ml
EUR 1521
Rnf41 3'UTR Luciferase Stable Cell Line
TU118012 1.0 ml Ask for price
RNF41 3'UTR GFP Stable Cell Line
TU070048 1.0 ml
EUR 1521
Rnf41 3'UTR Luciferase Stable Cell Line
TU219561 1.0 ml Ask for price

RNF41 Rabbit Polyclonal Antibody