SAR1A Rabbit Polyclonal Antibody

SAR1A Rabbit Polyclonal Antibody

Order Now:

SAR1A Polyclonal Antibody

ES9695-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SAR1A from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SAR1A Polyclonal Antibody

ES9695-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SAR1A from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SAR1A Rabbit pAb

A7476-100ul 100 ul
EUR 308

SAR1A Rabbit pAb

A7476-200ul 200 ul
EUR 459

SAR1A Rabbit pAb

A7476-20ul 20 ul
EUR 183

SAR1A Rabbit pAb

A7476-50ul 50 ul
EUR 223

Polyclonal SAR1A Antibody (Center)

AMM07709G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAR1A (Center). This antibody is tested and proven to work in the following applications:

Rabbit GTP binding protein SAR1a(SAR1A) ELISA kit

E04G0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit GTP binding protein SAR1a(SAR1A) ELISA kit

E04G0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit GTP binding protein SAR1a(SAR1A) ELISA kit

E04G0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SAR1A antibody

70R-20084 50 ul
EUR 435
Description: Rabbit polyclonal SAR1A antibody

SAR1A Antibody

46001-100ul 100ul
EUR 252

SAR1A Antibody

46001-50ul 50ul
EUR 187

SAR1A Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SAR1A. Recognizes SAR1A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SAR1A Antibody

DF9554 200ul
EUR 304
Description: SAR1A Antibody detects endogenous levels of total SAR1A.

SAR1A Antibody

AF4630 200ul
EUR 376
Description: SAR1A Antibody detects endogenous levels of SAR1A.

SAR1A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SAR1A. Recognizes SAR1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SAR1A Antibody

ABD9554 100 ug
EUR 438

Polyclonal SAR1A / SAR1 Antibody (Internal)

AMM07725G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SAR1A / SAR1 (Internal). This antibody is tested and proven to work in the following applications:

SAR1A Conjugated Antibody

C46001 100ul
EUR 397

anti- SAR1A antibody

FNab07601 100µg
EUR 548.75
  • Immunogen: SAR1 homolog A(S. cerevisiae)
  • Uniprot ID: Q9NR31
  • Gene ID: 56681
  • Research Area: Signal Transduction
Description: Antibody raised against SAR1A

anti- SAR1A antibody

FNab07602 100µg
EUR 548.75
  • Immunogen: SAR1 homolog A(S. cerevisiae)
  • Uniprot ID: Q9NR31
  • Gene ID: 56681
  • Research Area: Signal Transduction
Description: Antibody raised against SAR1A

Anti-SAR1A antibody

PAab07601 100 ug
EUR 386

Anti-SAR1A antibody

PAab07602 100 ug
EUR 386

Anti-SAR1A antibody

STJ29612 100 µl
EUR 277

Anti-SAR1A antibody

STJ190853 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SAR1A

Human GTP-binding protein SAR1a (SAR1A)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 49.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human GTP-binding protein SAR1a(SAR1A) expressed in E.coli


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-SAR1A(Thr139) Antibody

AF4330 200ul
EUR 376
Description: Phospho-SAR1A(Thr139) Antibody detects endogenous levels of SAR1A only when phosphorylated at Thr139.

Rat GTP binding protein SAR1a(SAR1A) ELISA kit

E02G0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat GTP binding protein SAR1a(SAR1A) ELISA kit

E02G0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat GTP binding protein SAR1a(SAR1A) ELISA kit

E02G0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse GTP binding protein SAR1a(SAR1A) ELISA kit

E03G0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse GTP binding protein SAR1a(SAR1A) ELISA kit

E03G0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse GTP binding protein SAR1a(SAR1A) ELISA kit

E03G0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat GTP binding protein SAR1a(SAR1A) ELISA kit

E06G0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat GTP binding protein SAR1a(SAR1A) ELISA kit

E06G0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat GTP binding protein SAR1a(SAR1A) ELISA kit

E06G0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GTP binding protein SAR1a(SAR1A) ELISA kit

E01G0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GTP binding protein SAR1a(SAR1A) ELISA kit

E01G0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GTP binding protein SAR1a(SAR1A) ELISA kit

E01G0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey GTP binding protein SAR1a(SAR1A) ELISA kit

E09G0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey GTP binding protein SAR1a(SAR1A) ELISA kit

E09G0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey GTP binding protein SAR1a(SAR1A) ELISA kit

E09G0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog GTP binding protein SAR1a(SAR1A) ELISA kit

E08G0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog GTP binding protein SAR1a(SAR1A) ELISA kit

E08G0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog GTP binding protein SAR1a(SAR1A) ELISA kit

E08G0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine GTP- binding protein SAR1a, SAR1A ELISA KIT

ELI-18887b 96 Tests
EUR 928

Porcine GTP- binding protein SAR1a, SAR1A ELISA KIT

ELI-29538p 96 Tests
EUR 928

Pig GTP binding protein SAR1a(SAR1A) ELISA kit

E07G0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig GTP binding protein SAR1a(SAR1A) ELISA kit

E07G0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig GTP binding protein SAR1a(SAR1A) ELISA kit

E07G0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GTP- binding protein SAR1a, SAR1A ELISA KIT

ELI-53188h 96 Tests
EUR 824

Mouse GTP- binding protein SAR1a, Sar1a ELISA KIT

ELI-53189m 96 Tests
EUR 865

SAR1A Blocking Peptide

DF9554-BP 1mg
EUR 195

SAR1A Blocking Peptide

AF4630-BP 1mg
EUR 195

SAR1A cloning plasmid

CSB-CL873630HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 597
  • Sequence: atgtctttcatctttgagtggatctacaatggcttcagcagtgtgctccagttcctaggactgtacaagaaatctggaaaacttgtattcttaggtttggataatgcaggcaaaaccactcttcttcacatgctcaaagatgacagattgggccaacatgttccaacactacatcc
  • Show more
Description: A cloning plasmid for the SAR1A gene.

Guinea pig GTP binding protein SAR1a(SAR1A) ELISA kit

E05G0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig GTP binding protein SAR1a(SAR1A) ELISA kit

E05G0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig GTP binding protein SAR1a(SAR1A) ELISA kit

E05G0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig GTP binding protein SAR1a(SAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SAR1A protein (His tag)

80R-1168 100 ug
EUR 305
Description: Purified recombinant Human SAR1A protein


EF002714 96 Tests
EUR 689

Human SAR1A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SAR1A Recombinant Protein (Human)

RP027598 100 ug Ask for price

SAR1A Recombinant Protein (Rat)

RP227465 100 ug Ask for price

SAR1A Recombinant Protein (Mouse)

RP169991 100 ug Ask for price

Monoclonal SAR1A Antibody (monoclonal) (M01), Clone: 3G5

AMM07710G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SAR1A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3G5. This antibody is applicable in WB

GTP-Binding Protein SAR1A Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Phospho-SAR1A(Thr139) Blocking Peptide

AF4330-BP 1mg
EUR 195

Sar1a ORF Vector (Rat) (pORF)

ORF075823 1.0 ug DNA
EUR 506

SAR1A ORF Vector (Human) (pORF)

ORF009200 1.0 ug DNA
EUR 95

Sar1a ORF Vector (Mouse) (pORF)

ORF056665 1.0 ug DNA
EUR 506

Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody

abx033062-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody

abx033062-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody

abx237601-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody

abx237602-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Secretion Associated Ras Related GTPase 1A (SAR1A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Human GTP-Binding Protein SAR1A

7-06319 5µg Ask for price

Recombinant Human GTP-Binding Protein SAR1A

7-06320 20µg Ask for price

Recombinant Human GTP-Binding Protein SAR1A

7-06321 1mg Ask for price

Sar1a sgRNA CRISPR Lentivector set (Rat)

K7359201 3 x 1.0 ug
EUR 339

Sar1a sgRNA CRISPR Lentivector set (Mouse)

K3392401 3 x 1.0 ug
EUR 339

SAR1A sgRNA CRISPR Lentivector set (Human)

K2089001 3 x 1.0 ug
EUR 339

Sar1a sgRNA CRISPR Lentivector (Rat) (Target 1)

K7359202 1.0 ug DNA
EUR 154

Sar1a sgRNA CRISPR Lentivector (Rat) (Target 2)

K7359203 1.0 ug DNA
EUR 154

Sar1a sgRNA CRISPR Lentivector (Rat) (Target 3)

K7359204 1.0 ug DNA
EUR 154

Sar1a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3392402 1.0 ug DNA
EUR 154

Sar1a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3392403 1.0 ug DNA
EUR 154

Sar1a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3392404 1.0 ug DNA
EUR 154

SAR1A sgRNA CRISPR Lentivector (Human) (Target 1)

K2089002 1.0 ug DNA
EUR 154

SAR1A sgRNA CRISPR Lentivector (Human) (Target 2)

K2089003 1.0 ug DNA
EUR 154

SAR1A sgRNA CRISPR Lentivector (Human) (Target 3)

K2089004 1.0 ug DNA
EUR 154

GTP-Binding Protein SAR1A Human Recombinant Protein

PROTQ9NR31 Regular: 20ug
EUR 317
Description: SAR1A Human Recombinant fused with 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 218 amino acids (1- 198 a.a.) and having a molecular mass of 24.5kDa.;The SAR1A is purified by proprietary chromatographic techniques.

SAR1A Protein Vector (Rat) (pPB-C-His)

PV303290 500 ng
EUR 603

SAR1A Protein Vector (Rat) (pPB-N-His)

PV303291 500 ng
EUR 603

SAR1A Protein Vector (Rat) (pPM-C-HA)

PV303292 500 ng
EUR 603

SAR1A Protein Vector (Rat) (pPM-C-His)

PV303293 500 ng
EUR 603

SAR1A Protein Vector (Mouse) (pPB-C-His)

PV226658 500 ng
EUR 603

SAR1A Protein Vector (Mouse) (pPB-N-His)

PV226659 500 ng
EUR 603

SAR1A Protein Vector (Mouse) (pPM-C-HA)

PV226660 500 ng
EUR 603

SAR1A Protein Vector (Mouse) (pPM-C-His)

PV226661 500 ng
EUR 603

SAR1A Protein Vector (Human) (pPB-C-His)

PV036797 500 ng
EUR 329

SAR1A Protein Vector (Human) (pPB-N-His)

PV036798 500 ng
EUR 329

SAR1A Protein Vector (Human) (pPM-C-HA)

PV036799 500 ng
EUR 329

SAR1A Protein Vector (Human) (pPM-C-His)

PV036800 500 ng
EUR 329

Sar1a 3'UTR Luciferase Stable Cell Line

TU118345 1.0 ml Ask for price

Sar1a 3'UTR GFP Stable Cell Line

TU168345 1.0 ml Ask for price

Sar1a 3'UTR Luciferase Stable Cell Line

TU219915 1.0 ml Ask for price

Sar1a 3'UTR GFP Stable Cell Line

TU269915 1.0 ml Ask for price

SAR1A 3'UTR GFP Stable Cell Line

TU072587 1.0 ml
EUR 1521

SAR1A 3'UTR Luciferase Stable Cell Line

TU022587 1.0 ml
EUR 1521

SAR1A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV634099 1.0 ug DNA
EUR 514

SAR1A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV634103 1.0 ug DNA
EUR 514

SAR1A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV634104 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

SAR1A Rabbit Polyclonal Antibody