UBR2 Rabbit Polyclonal Antibody

UBR2 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

UBR2 Polyclonal Antibody

ABP60845-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBR2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBR2 from Human, Mouse. This UBR2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBR2 protein

UBR2 Polyclonal Antibody

A66030 100 µg
EUR 570.55
Description: kits suitable for this type of research

Polyclonal UBR2 Antibody (Internal)

APG01236G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBR2 (Internal). This antibody is tested and proven to work in the following applications:

UBR2 Antibody

ABD9491 100 ug
EUR 438

UBR2 antibody

70R-51368 100 ul
EUR 244
Description: Purified Polyclonal UBR2 antibody

UBR2 antibody

70R-21131 50 ul
EUR 435
Description: Rabbit polyclonal UBR2 antibody

UBR2 antibody

70R-2651 50 ug
EUR 467
Description: Rabbit polyclonal UBR2 antibody raised against the C terminal of UBR2

UBR2 Antibody

43611-100ul 100ul
EUR 252

UBR2 Antibody

DF9491 200ul
EUR 304
Description: UBR2 Antibody detects endogenous levels of total UBR2.

UBR2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

UBR2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Polyclonal UBR2 Antibody (internal region)

APG00619G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBR2 (internal region). This antibody is tested and proven to work in the following applications:

UBR2 Polyclonal Antibody, HRP Conjugated

A66031 100 µg
EUR 570.55
Description: fast delivery possible

UBR2 Polyclonal Antibody, FITC Conjugated

A66032 100 µg
EUR 570.55
Description: reagents widely cited

UBR2 Polyclonal Antibody, Biotin Conjugated

A66033 100 µg
EUR 570.55
Description: Ask the seller for details

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody

abx431716-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody

abx239209-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

UBR2 Conjugated Antibody

C43611 100ul
EUR 397

anti- UBR2 antibody

FNab09209 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IF:1:10-1:100
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin protein ligase E3 component n-recognin 2
  • Uniprot ID: Q8IWV8
  • Gene ID: 23304
  • Research Area: Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against UBR2

Anti-UBR2 Antibody

A05812-2 100ug/vial
EUR 334

Anti-UBR2 antibody

PAab09209 100 ug
EUR 412

Anti-UBR2 antibody

STJ72039 100 µg
EUR 359

Anti-UBR2 antibody

STJ190796 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBR2

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase UBR2 (UBR2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17829 50 ul
EUR 363
Description: Mouse polyclonal to UBR2


YF-PA17830 100 ul
EUR 403
Description: Rabbit polyclonal to UBR2


YF-PA25864 50 ul
EUR 334
Description: Mouse polyclonal to UBR2

UBR2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBR2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBR2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBR2. Recognizes UBR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UBR2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

UBR2 Blocking Peptide

33R-7566 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBR2 antibody, catalog no. 70R-2651

UBR2 Blocking Peptide

DF9491-BP 1mg
EUR 195

UBR2 cloning plasmid

CSB-CL809001HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: atggcgtcggagctagagccagaggtgcaggccatcgaccggagcttgctggaatgttcggccgaggagattgcggggaaatggctgcaagcaactgacctcactagagaagtgtaccagcatttagcccactatgtacccaaaatctactgcaggggtcccaacccttttccac
  • Show more
Description: A cloning plasmid for the UBR2 gene.

Anti-UBR2 (4G4)

YF-MA17840 50 ug
EUR 363
Description: Mouse monoclonal to UBR2

Anti-UBR2 (4G4)

YF-MA17841 200 ul
EUR 363
Description: Mouse monoclonal to UBR2

Human E3 ubiquitin- protein ligase UBR2, UBR2 ELISA KIT

ELI-39986h 96 Tests
EUR 824

Mouse E3 ubiquitin- protein ligase UBR2, Ubr2 ELISA KIT

ELI-39987m 96 Tests
EUR 865

Human E3 Ubiquitin-Protein Ligase UBR2 (UBR2) ELISA Kit

abx384097-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse UBR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF004034 96 Tests
EUR 689

Human UBR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal UBR2 Antibody (monoclonal) (M01), Clone: 4G4

AMM04289G 0.05mg
EUR 659
Description: A Monoclonal antibody against Human UBR2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4G4. This antibody is applicable in WB and IF, E

Ubr2 ORF Vector (Rat) (pORF)

ORF078557 1.0 ug DNA
EUR 2080

UBR2 ORF Vector (Human) (pORF)

ORF011275 1.0 ug DNA
EUR 95

Ubr2 ORF Vector (Mouse) (pORF)

ORF060947 1.0 ug DNA
EUR 1572

Ubr2 ORF Vector (Mouse) (pORF)

ORF060948 1.0 ug DNA
EUR 1572

UBR2 sgRNA CRISPR Lentivector set (Human)

K2578301 3 x 1.0 ug
EUR 339

Ubr2 sgRNA CRISPR Lentivector set (Mouse)

K4275701 3 x 1.0 ug
EUR 339

Ubr2 sgRNA CRISPR Lentivector set (Rat)

K6245901 3 x 1.0 ug
EUR 339

UBR2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2578302 1.0 ug DNA
EUR 154

UBR2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2578303 1.0 ug DNA
EUR 154

UBR2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2578304 1.0 ug DNA
EUR 154

Ubr2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4275702 1.0 ug DNA
EUR 154

Ubr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4275703 1.0 ug DNA
EUR 154

Ubr2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4275704 1.0 ug DNA
EUR 154

Ubr2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6245902 1.0 ug DNA
EUR 154

Ubr2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6245903 1.0 ug DNA
EUR 154

Ubr2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6245904 1.0 ug DNA
EUR 154

UBR2 Protein Vector (Human) (pPB-C-His)

PV045097 500 ng
EUR 329

UBR2 Protein Vector (Human) (pPB-N-His)

PV045098 500 ng
EUR 329

UBR2 Protein Vector (Human) (pPM-C-HA)

PV045099 500 ng
EUR 329

UBR2 Protein Vector (Human) (pPM-C-His)

PV045100 500 ng
EUR 329

UBR2 Protein Vector (Rat) (pPB-C-His)

PV314226 500 ng
EUR 2926

UBR2 Protein Vector (Rat) (pPB-N-His)

PV314227 500 ng
EUR 2926

UBR2 Protein Vector (Rat) (pPM-C-HA)

PV314228 500 ng
EUR 2926

UBR2 Protein Vector (Rat) (pPM-C-His)

PV314229 500 ng
EUR 2926

UBR2 Protein Vector (Mouse) (pPB-C-His)

PV243786 500 ng
EUR 2926

UBR2 Protein Vector (Mouse) (pPB-N-His)

PV243787 500 ng
EUR 2926

UBR2 Protein Vector (Mouse) (pPM-C-HA)

PV243788 500 ng
EUR 2926

UBR2 Protein Vector (Mouse) (pPM-C-His)

PV243789 500 ng
EUR 2926

UBR2 Protein Vector (Mouse) (pPB-C-His)

PV243790 500 ng
EUR 2926

UBR2 Protein Vector (Mouse) (pPB-N-His)

PV243791 500 ng
EUR 2926

UBR2 Protein Vector (Mouse) (pPM-C-HA)

PV243792 500 ng
EUR 2926

UBR2 Protein Vector (Mouse) (pPM-C-His)

PV243793 500 ng
EUR 2926

Ubr2 3'UTR GFP Stable Cell Line

TU171503 1.0 ml Ask for price

UBR2 3'UTR GFP Stable Cell Line

TU077728 1.0 ml
EUR 1521

Ubr2 3'UTR Luciferase Stable Cell Line

TU121503 1.0 ml Ask for price

UBR2 3'UTR Luciferase Stable Cell Line

TU027728 1.0 ml
EUR 1521

UBR2 Rabbit Polyclonal Antibody